Aces High Bulletin Board

General Forums => Aces High General Discussion => Topic started by: daddog on April 28, 2000, 02:38:00 PM

Title: Where did you get your call sign?
Post by: daddog on April 28, 2000, 02:38:00 PM
It is slow at work today. Just so I have something to read today as the hours drag on...

First I was jwg--- in Warbirds. The switched to daddog when -budi-, (now docdog) and I formed the 332nd Flying Mongrels. I am a dad, and just had to put in the dog.  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

What is the story from the rest of you?
------------------------
daddog
332nd Flying Mongrels (http://www.ropescourse.org/flying.htm)
Snapshots (http://www.ropescourse.org/snapshot.htm)
 (http://www.ropescourse.org/cdaddog.jpg)
Where men become friends and friends become brothers
Title: Where did you get your call sign?
Post by: weazel on April 28, 2000, 02:49:00 PM
Just a variation of my last name Wenzel.
Title: Where did you get your call sign?
Post by: buhdman on April 28, 2000, 02:50:00 PM
Mine is in honor of my good friend (and good dog) Buhd, who I had to put to sleep a year or so ago.  Now he's with me whenever I fly.

buhdman, out

------------------
Walt (buhdman) Barrow
(formerly lt-buhd-lite)
The Buccaneers - "Return with Honor"
home.earthlink.net/~wjbarrow
Title: Where did you get your call sign?
Post by: Citabria on April 28, 2000, 02:58:00 PM
Mines from my first Aerobatic plane which I have such dear memories of   (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

7GCAA Citabria
 (http://www.aerobatic-training.com/acanim1.gif)

haven't flown it in to long though, all I have flown lately is pitts s2c   (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

that and I think the AirbatiC spelled backwards is kinda cool   (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

------------------
"There are no born fighter pilots. Some are a little better than others, thats about it. But I would say time, training, training, training and more training are the key... to any success."  -Francis Gabreski

Citabria
=357th Pony Express=

[This message has been edited by Citabria (edited 04-28-2000).]
Title: Where did you get your call sign?
Post by: Gunthr on April 28, 2000, 03:00:00 PM
 Thats cool, Buhdman...

Mine is just my last name, Guenther

That Citabria looks just like my old 7AC Aeronca Champ, which I believe was the pre-cursor to the Citabria??? Very nice bird, Citabria, I liked the skylight cabin top. What a sweetheart plane.

------------------
  (http://www.ropescourse.org/cgunthr.jpg)  

332nd Flying Mongrels



[This message has been edited by Gunthr (edited 04-28-2000).]
Title: Where did you get your call sign?
Post by: Pongo on April 28, 2000, 03:03:00 PM
I served in the Canadian Infantry(PPCLI) for seven years.
Pongo is (or was) the nickname that infanteers called themselves. It is the name of a small furry cartoon animal from the 40s(?) that dug holes for no good reason.


------------------
Pongo
The Wrecking Crew
Title: Where did you get your call sign?
Post by: Glasses on April 28, 2000, 03:16:00 PM
My nick went from  Burn ,because I usually got burned, to Glasses because I had to wear them and I'm obssesed about them. So now I am the 4 eyed devil.
Title: Where did you get your call sign?
Post by: Wanker on April 28, 2000, 03:20:00 PM
Anyone who's seen the film "This is Spinal Tap" will remember the scene where the heroes of the film meet an old "friend" in a hotel lobby. They chat with this fellow a bit, making nice small talk, but as soon as he leaves, they all call him a "banana".

At the time, I had no idea what a banana was, but it was still hilarious to me.

My British friends have since explained to me what a banana is, but I've decided to keep the name, anyways.   (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

------------------
 (http://www.raf303.org/308/308banner.gif)

"Turning Knight & Bishop sheep into lamb chops since 1999"

[This message has been edited by banana (edited 04-28-2000).]
Title: Where did you get your call sign?
Post by: ChickenHawk on April 28, 2000, 03:36:00 PM
Mine is from my favorite Loonytoon character, Henry Hawk (about 6" high), who is obsessed with trying to eat Foghornleghorn (about 6' high.) That little guy has spunk! Of course, that was back when they had real cartoons on tv, can't believe some of the crap they throw at my kids nowadays.

------------------
ChknHawk
"Your a chicken, I'm a chicken hawk. And I'm gonna eat chicken!"
Title: Where did you get your call sign?
Post by: skernsk on April 28, 2000, 03:58:00 PM
My brother used to tease me and call me Skernsky.  For some strange reason I have grown to like it.
Title: Where did you get your call sign?
Post by: rob53 on April 28, 2000, 04:04:00 PM
I have had rob53 since old AW on aol.  
Rob is first name and 53 is my badge number  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)
Title: Where did you get your call sign?
Post by: Azrael on April 28, 2000, 04:04:00 PM
Mine is from my fellow cat who shared her life with me for 9 years but had to be put to sleep last year due to cancer. I had this name before online, and decided to stick with it.

Az

 (http://www.link-goe.de/~m.henze/images/177k.gif)  
II.(K)/JG2
Title: Where did you get your call sign?
Post by: Fatty on April 28, 2000, 04:18:00 PM
I heard someone call someone "Hey Fatty!" once, and I said, gee, I'd like to be called fatty, so I called myself Fatty.

 (http://home.austin.rr.com/fdbfatty/images/FDBLogo1.gif)  (http://fdb.50megs.com)
Title: Where did you get your call sign?
Post by: bloom25 on April 28, 2000, 04:26:00 PM
Being the creative person that I am, I just combined my last name with a number.  (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)  I don't know why I picked 25, I just did when I entered my user name.  (I think it was because the person who told me about AH had a 24 at the end of their name.)  I've thought about changing it, but hey, a different user name won't make me any better.  (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)



------------------
bloom25
THUNDERBIRDS
Title: Where did you get your call sign?
Post by: Minotaur on April 28, 2000, 04:28:00 PM
My Father's name was Minotaur.  My Father's Father was a Minotaur.  My Father's Father's Father was also named Minotaur.  The name of my Father's Father's Father's Father was Minotaur.  

This was true for any of them and as far back as their Father's Father's Father's Father could remember.

I am currently the last descendent of a long line of Minotaur's.   (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

------------------
Mino
The Wrecking Crew
Title: Where did you get your call sign?
Post by: Sn1p3r on April 28, 2000, 04:35:00 PM
have a hard on for high powered sniper rifles.  The 1 and 3 were added just to be different.  Just so happened that when I started I flew bombers and I hit everything I released on..  (http://bbs.hitechcreations.com/smf/Smileys/default/rolleyes.gif)

My baby:

 (http://crystal.cleardata.net/~bpetting/ssg.gif)

and a write up ...
 http://www.remtek.com/arms/steyr/ssg/ssg.htm (http://www.remtek.com/arms/steyr/ssg/ssg.htm)

-Sn1p3r
Title: Where did you get your call sign?
Post by: easymo on April 28, 2000, 04:36:00 PM
 Mine is short for easymoney. A nick I picked up playing pool for a liveing in my mispent youth.

 I have often wished they would set up a CC account so that we could gamble. Ive seen a lot of "fun players", in pool.Wo were very good,fall apart when you set a hundred doller bill on the table. People have said they would like for a death to matter more. This might do it (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif).
Title: Where did you get your call sign?
Post by: Gman on April 28, 2000, 04:40:00 PM
Heh Easymo, we'll have to play some 8/9 ball at AH con.

P.S.  Bring Money
Title: Where did you get your call sign?
Post by: HaHa on April 28, 2000, 04:43:00 PM
Mine was originally HaHa, that I used when I first got onto CK (aka WB now). I was so excited and happy to be playing the game I gave myself the happiest nick I could think of   (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

Sometime later people mentioned that there was a LordHaHa in germany during WWII who broadcasted to the allies (music/propoganda etc..). So I changed my name to stay in the wwII theme   (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

btw citabria how did you do that nifty "picture slide show" in your post ?

[This message has been edited by HaHa (edited 04-28-2000).]
Title: Where did you get your call sign?
Post by: easymo on April 28, 2000, 04:53:00 PM
 Sorry Gman,  about 20 years ago,when I was working the road, I left a few grand out in San Jose. I promised the ol, lady i was gettin out of the game. Im to old now anyway. Eye,s are gone. Legs are gone. It will happen to you some day too (http://bbs.hitechcreations.com/smf/Smileys/default/frown.gif).
Title: Where did you get your call sign?
Post by: Revvin on April 28, 2000, 04:57:00 PM
It came to me in a blinding light, flashes of lighting and thunder as the name was hewn out of solid granite as eagles soared high in the crimson sky and lions roared...actually some bloke in work reckoned I drove like a bit of a nutter so the name stuck and I've used it online ever since (was rev1 in WB then later revvin)..boring really but that first bit was as interesting as I could make it  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

------------------
Revvin
249 Squadron RAF
Tangmere Wing
Title: Where did you get your call sign?
Post by: Gman on April 28, 2000, 04:59:00 PM
Lol I'm knocking on wood already Easy.  You worked the road huh?  Did nothing but play pool and paintball for $$ for about 5 years myself.  My wife will kill me as well if I gamble on pool again.  

I'm still playing amature pool in the BCA/VNEA legues, and usually the team gets a trip to Vegas out of it, but that is now the extent of my pool playing.

As far as my nick, my first name is Garra, and most people had trouble saying/remembering it, so all my paintball buddies just called me "Gman".  Nobody even remembers my name I don't think.
Title: Where did you get your call sign?
Post by: Saintaw on April 28, 2000, 05:23:00 PM
Earned myself the Nickname of "Saint" in my old F4 Squad , when I cae her in the Beta there was already a "Saint", so since I was posting on the BB from the office (Shhhhhhhhhhhht!) I went for "Saint At Work  AKA Saintaw"....

Saw is the short for it, & is esier for my mates to type SAW 6666666 than Saintaw  6666 !!!


------------------
Saw/Saintaw
=XO=II/JG2~Richthofen~
GMT T.O.D. SITE (http://www.wardogs.org/ah/)
(http://saintaw.tripod.com/saw190.gif)
JG2 "Richthofen" (http://www.busprod.com/weazel2/)
Don't shoot ! I am only an observer......
Title: Where did you get your call sign?
Post by: Cleaner on April 28, 2000, 05:53:00 PM
Clean \Clean\, a. [Compar. Cleaner; superl. Cleanest.] [OE. clene, AS. cl?ne; akin to OHG. chleini pure, neat, graceful, small, G. klein small, and perh. to W. glan clean, pure, bright; all perh. from a primitive, meaning bright, shining. Cf. Glair.] 1. Free from dirt or filth; as, clean clothes.

1a. Assasin, Hit-Man, Problem Solver  (http://bbs.hitechcreations.com/smf/Smileys/default/eek.gif)

2. Free from that which is useless or injurious; without defects; as, clean land; clean timber.

3. Free from awkwardness; not bungling; adroit; dexterous; as, aclean trick; a clean leap over a fence.

4. Free from errors and vulgarisms; as, a clean style.

5. Free from restraint or neglect; complete; entire.

When ye reap the harvest of your land, thou shalt not make clean riddance of corners of thy field. --Lev. xxiii. 22.

6. Free from moral defilement; sinless; pure.

Create in me a clean heart, O God. --Ps. li. 10

That I am whole, and clean, and meet for Heaven --Tennyson.

7. (Script.) Free from ceremonial defilement.

8. Free from that which is corrupting to the morals; pure in tone; healthy. ``Lothair is clean.'' --F. Harrison.

9. Well-proportioned; shapely; as, clean limbs.

A clean bill of health, a certificate from the proper authority that a ship is free from infection.

Clean breach. See under Breach, n., 4.

To make a clean breast. See under Breast.
Source: Webster's Revised Unabridged Dictionary, © 1996, 1998 MICRA, Inc.

--------------------------------------------------------------------------------


cleaner \Clean"er\, n. One who, or that which, cleans.
Source: Webster's Revised Unabridged Dictionary, © 1996, 1998 MICRA, Inc.

--------------------------------------------------------------------------------


cleaner n 1: a preparation used in cleaning something [syn: cleansing agent, cleanser] 2: the operator of dry-cleaning establishment [syn: dry cleaner] 3: someone whose occupation is cleaning

Title: Where did you get your call sign?
Post by: MarkVZ on April 28, 2000, 06:10:00 PM
Mark VanZwoll
Just my name condensed.
Pretty lame, eh?  (http://bbs.hitechcreations.com/smf/Smileys/default/rolleyes.gif)

------------------
Mark VanZwoll
33rd Strike Group
Title: Where did you get your call sign?
Post by: Jase on April 28, 2000, 06:14:00 PM
"JASE" was my childhood invisible friend. I got the name from one of the main characters in the cartoon "Space Ghost".   Now ya know  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

------------------
Jase
"To Everything Turn..Turn..Turn"
Title: Where did you get your call sign?
Post by: Camel on April 28, 2000, 06:41:00 PM
Faat was my old WB name until 2.1, then went with Shaker, but stopped playing shortly after.

Lost my password for my old name(Warnin) in DOA beta. I needed to come up with a nutter, so because I flew the F1 camel, Camel it became.
Title: Where did you get your call sign?
Post by: -duma- on April 28, 2000, 07:14:00 PM
My callsign was Lister after the character in the TV series Red Dwarf who is a complete slob with few redeeming features (It was a sort of rebellion against callsigns like Cobra, Viper etc). However, since I got the callsign Red Dwarf went downhill seriously and I wasn't much of a fan of the show any more - a pity, since every @#*&ing 13 year old who loved the show was searching for 'lister' on ICQ and messaging me 'Do u like Red Dwarf?' - About 20 people a week at one point, and I'm not joking! Also about this time I started playing Counter-Strike in the UK and found several Listers, which got a little annoying..

Anyway, since my heart wasn't in that callsign much anymore I needed a switch - I'd just decided to sign up for a pay account with HTC since I heard the Typhoon was coming out soon. I wanted an original name, and since I've admired cheetahs (Which, the fastest land animals, are pretty much like the Tiffie in that respect) I picked what had to be the most unlikely name to be found anywhere else on the internet - the Swahili name for cheetah, Duma.

Now I don't have 13 year olds asking me if I like Red Dwarf - I have people asking me why I named myself after the Russian parliament. Someone gimme a gun  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

Oh, in case there are any other Counter-Strikers, due to my incompetence at that game I don't go by Duma (That's only for showing my incompetence in sims), I go by the name Mr.Snipey. You can spot me in Barrysworld or GamesInferno servers, somewhere down the lower end of the score board and constantly making jokes that no-one laughs at. Pretty much like AH  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)
Title: Where did you get your call sign?
Post by: BD on April 28, 2000, 07:27:00 PM
I used to be Salto in WB, because I flew and owned an aerobatic Salto glider for a number of years.  

When I changed accounts in WB, I picked BD because those were the contest letters of my new glider at the time, an LS-4.  Just carried BD over into AH.

Unfortunately, AH has become my only flying (and occasionaly gliding) since I let my BFR lapse last fall.  (http://bbs.hitechcreations.com/smf/Smileys/default/frown.gif)
Title: Where did you get your call sign?
Post by: Aerotech on April 28, 2000, 07:32:00 PM
Well, when I was signing up for AH I couldn't use any of the 15 or so nicknames I tried. I kept getting the "that nickname is in use" message.

Then my wife came into the room with our crying and fidgeting 2 month old daughter and said, " here, go see your pa."

So that name stuck.  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)
----------------------
Pa

p.s. I joined this board before I signed up for AH but didn't want to use the aerotech name in the game. hehe
Title: Where did you get your call sign?
Post by: Spoons - SimHQ on April 28, 2000, 07:52:00 PM
Probably started with my grandfather, who was called Spoony by his B-24 flight crew in the war.  Stuck with him, stuck to my Dad growing up, and stuck with me until college, until I gradually started changing it to Spoons.

My last name is not really pronounced "spoon-hour," but but throughout my life, maybe 3 people have gotten it right ("spon-hour")    (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)

So Spoons it is.


------------------
John Sponauer
Senior Editor, SimHQ.com
jsponauer@simhq.com
Title: Where did you get your call sign?
Post by: JimBear on April 28, 2000, 07:55:00 PM
Had the nicname at work for years of HairBear (looked like Jerry Garcia on a bad hair day) when I started to fly online I found the nic was taken so, JimBear it became. Turned out best in the long run, cuz now I look more like fuzzy wuzzy   (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)

------------------
 (http://www.devildogs.com/vmf111/jbsig.gif)

[This message has been edited by JimBear (edited 04-28-2000).]
Title: Where did you get your call sign?
Post by: Kieren on April 28, 2000, 08:58:00 PM
Was going to name my son "Kieren", because it was the only name I could think of that didn't have a bad memory associated with it (teachers hear them all). As it turned out, I had two daughters. There won't be a strike three.   (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)

[This message has been edited by Kieren (edited 04-28-2000).]
Title: Where did you get your call sign?
Post by: Fariz on April 28, 2000, 09:29:00 PM
It is a long story...

Many years ago I was born and parents gave me the name Fariz, what is "Knite" in arabic (still do not know why I fly for bishops?  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif) I used callsign Wizard for almost 8 years in games and communications thru net, but after some consideration I decided that sometime I am not as good as want to be, and also my name is GREAT!  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif) So I decided to stay with it.

Fariz. Fariz. Fariz.  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif) (Just love how it sounds)
XII Legion
Title: Where did you get your call sign?
Post by: eagl on April 28, 2000, 09:36:00 PM
I started out playing CK/WB as "suck" because... well, I wasn't too good to begin with.  It was also fun to be able to answer people who said "you suck" or "I suck" with "no, I'm suck!"  Yea, kinda stupid really.  Anyhow...

A month or two later, I got my assignment out of pilot training to go fly the F-15E, so I changed my ident to eagl (with an L  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif) )  I dueled only once for my ident, against someone who was using eag1 (with a one) and he was gracious enough to give up his ident after the duel series.


------------------
eagl <squealing Pigs> BYA
Oink Oink To War!!!
Title: Where did you get your call sign?
Post by: Sundog on April 28, 2000, 10:04:00 PM
I'm one of those guys who started flying in Fighter Ace under my brothers account (Master of Sparks...now Shortened to Sparky) and I learned to love online Combat Flight Sims from that.  

Having flown in FA for a couple of months, I was approached and asked to become a member of the Devildogs Squadron, so I started looking for names that had to do with aerial phenomena, such as Tornado, Tempest, Storm, etc.

Most of those names were already taken when I suddenly remembered `sundogs fire on the horizon' as a lyric from a Rush song. Knowing what sundogs were and joining the Devildogs, I thought the name was kinda of cool, so that's what I used.

 (http://devildogs.com/vmf111/sdsig.gif)



[This message has been edited by Sundog (edited 04-28-2000).]
Title: Where did you get your call sign?
Post by: Lance on April 28, 2000, 11:12:00 PM
I looked down at my waist.

Gordo
Fat DRUNK Bastards (http://fdb.50megs.com/)
Title: Where did you get your call sign?
Post by: PropNut on April 28, 2000, 11:46:00 PM
Mines just what it says  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)  having worked on all kinds of aircraft,and a few old warbirds, my prefrence has always been the old prop driven warbirds. nothing sounds better than an old oil spitting radial   (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif) so im just a PropNut
Title: Where did you get your call sign?
Post by: 78con on April 28, 2000, 11:47:00 PM
Great thread Daddog! Much beter'n Etiquitte in the Training Arena

the 78 is the year of my birth. I got it when i was signing up for a yahoo mail account. Since i have two of the most common names on the planet (Aaron Smith) the sever suggested i attach my birth year.
the con is carried over from another bbs. there i am 78convert. short for 1978 convertible (my dodge ramcharger). The ah handle was limited to 78con which I serendipidously (sp?) enjoy very much.
being a con is more fun than the actual running i mostly do !!
btw : what was jwg?? judge ?

[This message has been edited by 78con (edited 04-28-2000).]
Title: Where did you get your call sign?
Post by: Luckie on April 29, 2000, 12:13:00 AM
on the irc channel #fscombat, i started using the name "lkjjj" simply because it was exceptionally easy to type (look at the keyboard). when i eventually started using that name in WB, i rationalized that it was very easy to type so i would get better six calls. probably no truth to that (since tyoping it doesn't come as natural to the left hand). but in any event, the squad mates eventually got tired of having someone with an unpronouncable name. a few tried to dub me "luckjug", so that they had a pronouncable nickname that bore some resembelance to the WBid. luckjug was not acceptable to me, but we compromised on "lucky" (also good since by that time i was doubling the K/D of anyone else in the squad). i eventually sttled on luckie as a varient spelling since that was available as a WBid ("lucky-" was taken).
that is all....
-luckie
Title: Where did you get your call sign?
Post by: indian on April 29, 2000, 12:46:00 AM
Started out as TLT11 in AW went to TLT19 quit the squad I was in (they flew relaxed realism and still do to this day) Went back to TLT11 and then to Snupe (because snoopy was taken and so was snupy my dogs name and yes he is a beagle) from there I became INDN because thats all that fits in AWIII I was also snupe in WB the first time I tried it. Then INDN in  WB and indian in Aces high should of staid with the short version.

How I came up with indian(INDN) is I am 1/4 Cherokee 1/2 american mutt and 1/4 british ( family tree goes all the way back to 1520's)
Didnt want to use chief so picked indian.

------------------
Tommy (INDIAN) Toon
  1st Aces High Trainer Corps.
Home of The Allied Fighter Wing A.F.W.
A.F.W. Homepage (http://www.geocities.com/~tltoon)
Title: Where did you get your call sign?
Post by: Toffer on April 29, 2000, 01:32:00 AM
Started out in FA as Hildy., but since I spent so much time going down in flames I changed it to ToF (Tails on Fire). Somewhere along the line the "fer" got added. So here I am Toffer.

Still am damn good at skywriting   (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)
Title: Where did you get your call sign?
Post by: Waxer on April 29, 2000, 01:40:00 AM
"to wax" is a verb in both surfing and dogfighting, so I've been Waxer since 1988-ish.

Plus, it's historically accurate: Japanese historical scenarios have Waximoto, and in German its Wachser.

But I have an evil twin called El Tio Suave.
Title: Where did you get your call sign?
Post by: leonid on April 29, 2000, 02:14:00 AM
Started in WB1.09 as batu, my cat's name, which is incidently the name of a Mongol Khan.  When my wingie and I decided to form a VVS squad I changed it to leonid, which is a play on my last name (Leon Guerrero), and Russian.

------------------
leonid, Komandir
5 GIAP VVS RKKA (http://www.adamfive.com/guerrero)

"Our cause is just.  The enemy will be crushed.  Victory will be ours."
Title: Where did you get your call sign?
Post by: blitz on April 29, 2000, 02:16:00 AM
When i started online simming 1,5 years ago in WB2.01 german version i looked  for a short callsign & it should be in german.
Found Blitz what means flash or lightning in english.
Love to come down like a Blitz  from a thunderstorm at the AcesHigh skies right on your six  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

blitz
Title: Where did you get your call sign?
Post by: StSanta on April 29, 2000, 02:59:00 AM
My earlier nick (and still my irc nick) was Marvin, from Hitchiker's Guide To The Galaxy - a very depressed superintelligent android with an arrogance that is unrivalled.

Later, due to my first name being Claus and my words and conduct in one newsgroup were so admirable, noteworthy, saintlike and generally superior to all that has been experienced, I was inofficially nicked "Santa" with an additional "of EAC" so show my evil affiliation.

Dunno, I sort of like being a fat drunken bastard that gts to dress in red without being made fun of and sneak down people's chimneys to check their computers for porn.  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif).

That's my story and I might stick to it. No guarantees.

--
StSanta
Title: Where did you get your call sign?
Post by: crabofix on April 29, 2000, 03:13:00 AM


There is this fishmongler in the comicbook asterix, that I borrowed my name from. Hes always getting jumped on and in fights because of his "rotten" fish.
The swedish name for this guy is Crabofix.
I have a lot to do with fish and it suits me good.

Crabofix "a man who´sellfish"
Title: Where did you get your call sign?
Post by: StSanta on April 29, 2000, 05:21:00 AM
You're now formally Bork Crabofix.

Ensure that you change your real life name to this.

And fishies are our friends, I hope you don't kill them.

Fishies are cool. They can, uhm, stay underwater for long, errr, periods of time, I guess...

I had an argument in my head, but lost it.
Title: Where did you get your call sign?
Post by: Duckwing6 on April 29, 2000, 06:34:00 AM
I've been IrraIwan (crazy Iwan) in my first online game as there was "hunt for red October" playing on TV in the background and THAT's what they shouted when i was just thinking of a nickname.. Then i came to my first squad and "earned" my number beeing Duckwing6 i kept the nik even after the squad crumpled.. in AW i flew as DW6 and here i'm SCDuckwing6 wearing the moniker of my new squad .. even tho most people seem to call me SCD or duck  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)

QUUUUUUUuuuuuuuACK!
 (http://members.aon.at/duckwing6/dw601.gif)
Title: Where did you get your call sign?
Post by: air_spro on April 29, 2000, 07:18:00 AM
Started out as spro400 , short for sprocket and the ci engine size of my offroad truck . I got sprocket hung on me cause I used to ride Motorcycles lots when I was young  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif) . Changed it to air_spro when I met up with sid  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif) .  
 www.sprocketsworld.com (http://www.sprocketsworld.com)  

Get it , hehe , I am a Wayne too .  (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)
Title: Where did you get your call sign?
Post by: RangerBob on April 29, 2000, 07:28:00 AM
Great thread and I'm glad you started this.

Mine is obvious. I'm an old Airborne Ranger. I've been called Ranger Bob since I got out of Ranger School. The name attached is usually the best one that fits being either your first or last name such as my ranger buddy called Ranger Finn.

God I love to see those C47 drops!

Ranger Bob
Title: Where did you get your call sign?
Post by: Beefcake on April 29, 2000, 07:32:00 AM
Got it from Southpark, have had it ever since.


The Cow in the Sky
Title: Where did you get your call sign?
Post by: Badger on April 29, 2000, 08:45:00 AM
Although this is a thread we've seen many times before, I always enjoy reading about how some of you guys got your handles.

I have been involved with Warbirds since v1.1 and originally flew then with the call sign of -dach-, which is rough German translation for a badger, my present nickname.  I picked it because my wife and I own a pair of Dachshunds (badger dogs) and because when I trained with the Canadian Airborne Regiment as a  paratrooper back in the 60's, "badger" was my Ranger section's (long range patrolling) call sign.

Regards,
Badger
Title: Where did you get your call sign?
Post by: LLv34_Snefens on April 29, 2000, 09:15:00 AM
I use a nick that was given to me by one of my fellow students when I started at the university some years ago.
During his high-school time this guy had classes with a guy named Stefan (just like me). Unfortunately for this Stefan the school by some freak accident had mistyped his name when entering him in the registry and given him the name Snefens instead. As I was told this name was still printed on his papers when he graduated.
So basically when I met this guy's friend and he heard my name was Stefan he started calling me Snefens too. After a while all the students started calling me Snefens too and as I thought it was a kinda cool name I used it when I started flying online. Or just Snef for short.

------------------
Ltn. Snefens
RO, Lentolaivue 34 (http://www.muodos.fi/LLv34)
Title: Where did you get your call sign?
Post by: Westy on April 29, 2000, 09:27:00 AM
 Oh great! Um? Westy huh? <looks down depressed>
 ferRrget it. There is no story. What a lame handle hmmm? How about?   "Toxic" !!!???

 (sick of 'Westy'. considering a new one now that everyone has even a minimal story behind their handle)

    -- (fill in the blank for now)
Title: Where did you get your call sign?
Post by: Skuzzy on April 29, 2000, 10:16:00 AM
Well, I have had this nick since high school.  Someone referred to me as being skuzzy one day and the nick stuck throughout college.

It got somewhat retired after college, but then in 79 I help to create and market a product for Adaptec called the AHA-1540, which became the most successful SCSI host adapter around.

During that time I got to be known as Mr. SCSI.

Well, the pronunciation for SCSI is Skuzzy (although originally it was called Sexy, but out of fear of those anti-sexist women, the pronounciation was changed to "skuzzy").

After that, the nick just stuck.  Who am I to argue with destiny?  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)


------------------
Roy "Skuzzy" Neese
President, AppLink Corp.
http://www.applink.net
skuzzy@applink.net
Title: Where did you get your call sign?
Post by: ra on April 29, 2000, 10:58:00 AM
Chicks dig me, because I rarely wear underwear, and when I do it's usually something unusual...
Title: Where did you get your call sign?
Post by: RANKER_ONE on April 29, 2000, 11:23:00 AM
I lost my sargent rank after a ­­"scrap" with
an officer.

That fkr was in civilian cloths so I didn't
know (befor the scrap) lol.

So since then RANKER it is   (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)

....he went downd like a rock    (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)

I would like to know where RIPSNORTgot
is nick ...wath about you guys  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)



[This message has been edited by RANKER_ONE (edited 04-29-2000).]
Title: Where did you get your call sign?
Post by: Ghosth on April 29, 2000, 12:27:00 PM
GhostHawk on kali a LONG time ago, was flying A-10 Cuba guns only. Warbirds would only let me have 6 letters so ghosth it became & stuck. it's rotated to ghostt a time or two.
(Fight Opps, free weekends, etc.)

But mostly it's just Ghosth, now I'm here, now I'm not, oops, check your 6!

Title: Where did you get your call sign?
Post by: Greg 'wmutt' Cook on April 29, 2000, 12:37:00 PM
Wmutt is short for Wondermutt, a feral dog I rescued from the parking lot of the dog pound about 5 years ago.  He got his name by getting hit by a car 3 days after I got him, and the Vet needed a name to attach the $700 bill for a metal plate in his left hip to.  I remember thinking "I wonder how much this mutt will cost."  I was at a pretty low point in my life at that time, and we became the best of friends, helping each other through some pretty tough times.  So ever since the AOL Air Warrior days I have been 'wmutt'.
He probably wouldn't be as flattered by the tribute as he should though, because most of the time I'm flying he feels would be better spent out chaseing squirrls and rabbits  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

--------------------------
 (http://www.ropescourse.org/cwmutt.jpg)
332nd Flying Mongrels (http://www.ropescourse.org/flying.htm)
"When in doubt, put a few more rounds into it."
Title: Where did you get your call sign?
Post by: BigJim on April 29, 2000, 03:24:00 PM
Heheh ask Ranger Bob where I got my handle <grin>
Title: Where did you get your call sign?
Post by: daddog on April 29, 2000, 04:22:00 PM
Wow! Started this early Friday it was about half this size when the day was over.  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)
Thanks for all the responses gents! Some I have really enjoyed, others....more than I wanted to know.  (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)

Your right badger I have seen this several times, but it is always a good read. 78con, jwg was just my initials, James William Glazier.  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

I would like to hear from more...how about the HTC crew?
-------------------
daddog
332nd Flying Mongrels (http://www.ropescourse.org/flying.htm)   
Snapshots (http://www.ropescourse.org/snapshot.htm)
Where men become friends, and friends become brothers.
 
Title: Where did you get your call sign?
Post by: DoZZ on April 29, 2000, 04:29:00 PM
I guess I came by my callsign honest. When I worked in the sawmill's of eastern Tenn. no one went by given names. Everyone had a nick like Motor or Scratch or something. It was said that Motor could lift a 4cyl. and carry
it under one arm...he was a big boy :^) and you dont want to know what Scratch's problem was :^) So they studied for weeks for a nick for me.I finnally gave them the excuse one day cleaning up after work. I took a 2x4 and used it to cleaned out from under one of the saw's. they said it looked like I was bull dozing...:^) So Dozer was born on that fatefull day. I thought it fit well cause I love the down an dirty fights on the deck.
Since then my WB squad mate's would shorten it with doze or dozz, so DoZZ it is ... ;^)
Title: Where did you get your call sign?
Post by: treadhead1 on April 30, 2000, 10:50:00 PM
Well, mines pretty easy to. I was a tanker on M1A1s stationed in Vilseck, Germany for 3 yrs. (just got out in Aug 99) It amazes me hoe many ex-tankers are here in AH. Guess we like flying  a plane rather than slogging around in the mud!

Just ask anyone who has trained at Grafenwhoehr or Hohenfels. (and i know you guys are out there!)


Tread  
>>The Screamin Meanies<<
Title: Where did you get your call sign?
Post by: Sox on May 01, 2000, 12:14:00 AM
Was Grim Reaper in AW3, Callsing was Riper, can only get 5 letters in the box so missed the other P in the name. Couldnt get Ripper in this game was already takin and tried many others, Spent forever to find a name. So The White Sox wone the World Sieres Last year and found that A short callsign was qwicker to typ for 6 calls so took the name Sox. The bad thing is that people dont get the Baseball out of it. Thay end up geting The Presidents cat.  But o well. Sad to say would love to change it now.
Title: Where did you get your call sign?
Post by: Spatula on May 01, 2000, 12:40:00 AM
My handle comes from being the stupidist sounding Kitchen Utensil. I had envisioned a mighty plethora of Kitchen Utensils gracing the AH virtual skies going by the name:
1st Airborne Kitchen Utensil Assault Group.

It would seem that others dont seem to want to have a silly handle so i disbanded the sqaud after a few months. We had:
 - Spatula
 - Grater
 - Ladle
 - Corkscru
I had an offer for a ginsu2000.

But i was the only one who actaully signed up when we went pay, so i joined some new-found friends in the 357th Pony Express and kept my handle cause it sounds silly (and it was well known)


Spat
= 357th Pony Express =



[This message has been edited by Spatula (edited 05-01-2000).]
Title: Where did you get your call sign?
Post by: Spooky on May 01, 2000, 04:46:00 AM
Hehe ! I used to show up at my local firing range with five guns ...I used to fire two  black powder .45's at once and was nicknamed SPOOKY in reference to the Vietnam-era C47 gunship by a U.S friend who was visiting that day...I liked the reference so I kept the name...

------------------
[IMG]http://www.geocities.com/almattia/alsace3.jpg/[IMG]
Title: Where did you get your call sign?
Post by: air_borg on May 01, 2000, 08:04:00 AM
Well...I have the deepest respect for anyone that can assimilate an entire species...especially when its in a cockpit being thrown around in all directions  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)

So Im "the borg" (just dont expect me to be as good lookin as 7 of 9)  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)



------------------
We fly 4 fun
Title: Where did you get your call sign?
Post by: Ripsnort on May 01, 2000, 08:21:00 AM
Long story short, used to break horses, was bucked off onto a barb wire fence, which almost castrated me.  After returning from the hospital stitched up, my dad returned from work that day and said "Looks like you had  a "Ripsnortin' good time!".  Name stuck.

To this day when I see an urban cowboy with a hat on, I feeled compelled to  walk up to him and scream "Did you EARN that friggin' cowboy hat, mister, or you just playin' the part!"

------------------
Ripsnort(-rip1-)
I./JG2~Richthofen~
Panzer Group Afrika-15th Panzer division
JG2 Communications Officer
Aces High Training Corps

JG2 "Richthofen" (http://www.busprod.com/weazel2/)
 (http://saintaw.tripod.com/ripsnort.jpg)
Too often, we lose sight of life's simple pleasures.  Remember, when
someone annoys you it takes 42 muscles in your face to frown, BUT, it
only takes 4 muscles to extend your arm, grasp the joystick button,
and shoot the sucker down!


[This message has been edited by Ripsnort (edited 05-01-2000).]
Title: Where did you get your call sign?
Post by: pzvg on May 01, 2000, 09:14:00 AM
First, back in AW on Compuserve, I was IRA,For no reason,then Got into WB about 0.95 version,My R/l nick is Bear,but that being taken, was casting around for something and hit on the 7up spotad, so I became SPOT, bad idea, seems there had already been a SPOT who had been a jerk, so after the 5th or 6th time of being a victem of a "dweebhunt" out of mistaken identity, I was ready for a new handle, but what? well I liked tanks had been a tanker, (yeah treadhead I remember Graf '80-'88) and I liked WWII german equipment so I settled on my favorite the Panther, now pant it would have been in the old WB handle, umm no, uncool, hmm PanZerkampfwagen 5(V) ausf G?
PZVG? sounds good  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif) and it has ever since.

------------------
pzvg- "5 years and I still can't shoot"
Title: Where did you get your call sign?
Post by: Mighty1 on May 01, 2000, 09:59:00 AM
Had several names but started with Mighty1 in the Fighter Duel and Fighter Ops days and used it and Target/Udi in Flying Circus and Dewey- in WB/DOA.

I sucked so bad when I first started flying I decided I should have a scary sounding name so that people (Hopefully) would think twice about attacking me so I chose Mighty1.

------------------
Mighty1
The New Baby Harp Seals

"Come try to club THIS Seal"
Title: Where did you get your call sign?
Post by: sourkraut on May 01, 2000, 10:11:00 AM
Back in the CB radio days my (ex)Mother in law suggested sourkraut for my handle.
Only 8 letters allowed so its sourkrau

Sour

------------------
Sourkraut
JG-2 Richthofen (http://www.busprod.com/weazel2)

"Hey - someone has to be the target...."

(http://saintaw.tripod.com/sour.jpg)
Title: Where did you get your call sign?
Post by: StSanta on May 01, 2000, 10:12:00 AM
Hey rip, I want one of them cowboy hats.

And a gun to go with it, the bigger the better.

And leather pants stuff, dunno what you call them.

Boots would be cool too, just to complete the image.

No damned horse though, those critters are insane.

Guess I'll look pretty lame, with my 180cm, 65kg frame, in a red cowboy hat, red boots, white fake beard and a Big F*cking Gun, riding a red offroad bike  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

But, the chicks will dig it. Or maybe not. Anyway, *I* would consider myself Extremly Cool And Very Tough, and that's a good thing.

Or maybe one of them cool Aussie hats, I like those.

Or a German helmet, but people would label me a Nazi, even though it is red and wears the insignia "Rudolph is dead, I got hungry".

Even considered a red drysuit for my diving, but black and yellow was cheaper  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)

--
StSanta
II/JG2
Title: Where did you get your call sign?
Post by: Mickey1992 on May 01, 2000, 10:23:00 AM
Mickey - Derived from McCormick
Title: Where did you get your call sign?
Post by: Belgar- on May 01, 2000, 10:26:00 AM
Started out as Pegasus from games like WW2 Figthers from Janes and some helo sims, then came Warbirds over a year ago and a seven letter words wouldnt fit like Pegasus, i chose Pegsus then made Belgar at the same time came from one of the characters off David Eddings novels. Both still fly but Belgar is my regular flyer.

------------------
Belgar
 (http://freespace.virgin.net/revvin.revvin/213_Banner1.jpg)

[This message has been edited by Belgar- (edited 05-01-2000).]
Title: Where did you get your call sign?
Post by: JENG on May 01, 2000, 10:35:00 AM
My former handle was JENG which is just a sort abreviations of my family name Engelen.

When I started playing AH in beta I wanted something that was easy to type (I need 6 calls alot  (http://bbs.hitechcreations.com/smf/Smileys/default/tongue.gif)) and had some special meaning to me.

I called myself bee cause my girlfriends name is maya (Germans should now the cartoon with a bee called maya)and cause it's easy to type. BTW I like the little black/yellow striped bastards  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)

------------------
BEE(JENG)
=CO=II/JG2~Richthofen~
JG2 "Richthofen" (http://http://members.tripod.com/JG2/)
(http://nottosc.tripod.com/109bee.gif)
'Nemo Me Impune Lacessit'
Title: Where did you get your call sign?
Post by: LuckyDay on May 01, 2000, 12:55:00 PM
Ned Nederlander and Dusty Bottoms are more than 8 characters long...


"Would you like to kiss me on the veranda?"
"Lips would be fine..."

(actually that's Dusty back when Chevy Chase was funny...)
Title: Where did you get your call sign?
Post by: mudder on May 01, 2000, 02:03:00 PM
Should have been in the infantry
Title: Where did you get your call sign?
Post by: Beegerite on May 01, 2000, 08:16:00 PM
First, if you get down this far I suggest you change your nick to "Getalife"
Now, since you asked,
Beeger is short for Beegerite which is the name of my 30' Southwind motorhome aka "Pretty Boy Beeger".  I knew that if I used the nick "PrettyBoy" I would be attacked mercilessly and also since Beegerite didn't fit I used the proper Beeger.  Going on with the saga, Beegerite is what my wife and I call ourselves when motorhoming because we're Beegies which was taken from the pet name we gave each other in 5th grade O.B. (as opposed to B.O.) which was an abbreviation for Oney Bucket which was our code word for Honey Bucket.  This may seem confusing to all of you but it all comes together for me on National O.B. Day which is celebrated on April 17th and commemorates the day in '57 when I schlepped down to the local jeweler 3 times to buy her a friendship ring which would fit her.  It must have been the right fit cause we've been married for 38 years and sweethearts for 43  To the casual observer of OB-dom it may not be apparent that this must be ingrained in my brain right alongside my own name and shirt size because should I forget any of these facts or the O.B. Creed; "I am an O.B. because I was meant to be, I want to be and you want me to be", I could be immediately de-obitized and that's worse than being killed by a thousand Bish.
Beeg  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)

Title: Where did you get your call sign?
Post by: Jochen on May 02, 2000, 04:46:00 AM
 (http://historie-asow.elk.com.pl/foto1/marse3.jpg)

------------------
jochen

Geschwaderkommodore (on leave) Jagdgeschwader 2 'Richthofen' (http://personal.inet.fi/cool/jan.nousiainen/JG2) (Warbirds)

JG 2 'Richthofen' (Aces High)

I want to believe! Fw 190F-8 / G-8 / D-9 to Aces High!

Thanks for the Fw 190A-5 HTC!

Ladysmith wants you forthwith to come to her relief
Burn your briefs you leave for France tonight
Carefully cut the straps of the booby-traps and set the captives free
But don't shoot 'til you see her big blue eyes
Title: Where did you get your call sign?
Post by: Rude on May 02, 2000, 10:23:00 AM
I'm just not a very nice guy (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

Easymo....give me the 7 and the break and I'll race ya to 10 for $100.00 (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

Cyas Up!

Rude Out!
Title: Where did you get your call sign?
Post by: Swager on May 02, 2000, 11:20:00 AM
As a submarine sonar technician we use to SWAG (Sonar Wild Assed Guess) the classification of a contact.  Most of the time my swags were correct.  The only thing I was ever good at.  I was hoping it would rub off on my flying.  Oh Well!  Better luck next time!!

Cyas up!!

------------------
Swager
I/JG2~Richthofen~
"Damn.....I can't believe I missed that shot!!!"
 (http://saintaw.tripod.com/swager.jpg)
JG2 "Richthofen" (http://www.busprod.com/weazel2/)

[This message has been edited by Swager (edited 05-02-2000).]
Title: Where did you get your call sign?
Post by: bike killa on May 02, 2000, 11:25:00 AM
Hia!
History of beginning this nick was simply:
When I was younger, often rides on rollerblades and once I crashed with cyclist
I had only several of scratches, and cycle this man was shattered completely  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif) and then familiar was started to call me bike killer  (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)

------------------
bikekil
308 (Polish) Squadron RAF "City of Cracow"
Title: Where did you get your call sign?
Post by: Borg on May 02, 2000, 12:19:00 PM
My first choice was BOOMER which was my callsign in Air Force pilot-training. My second choice was BOHICA : "bend-over, here it comes again" (the motto of many Eastern Airlines pilots).  Alas, both of these names were already taken, so I settled for BORG which is short and has a bit of contemporary humor associated with it.

------------------
Regards,

Tom Bigelow, Borg

My Page: http://members.xoom.com/borg999/aviation-1.html (http://members.xoom.com/borg999/aviation-1.html)  
Rogue Gryffons
Title: Where did you get your call sign?
Post by: Ouch on May 02, 2000, 01:26:00 PM
<double post>

[This message has been edited by Ouch (edited 05-02-2000).]
Title: Where did you get your call sign?
Post by: Ouch on May 02, 2000, 01:28:00 PM
Repost from one of my myriad posts on this subject:
------------------------------------


Theres a long story behind this, and that makes it a valid call sign.

The first thing you need to remember is that there are three types of call signs:

    Ones you give yourself
    Ones given to you by your friends (hehehe)
    Ones that you earn by nigh unto legendary acts.

The first are the kind that you see in the movies. Maverick, Iceman, etc. Cute, but really only says what the person wishes
were true about himself }:> (sounds of flame throwers cranking up in the background.)(duck, dodge, weave)

The second is for just being you. It usually is a play on words dealing with the pilots name or characteristics about him. ie
"Duke" for someone named Ellington, "Rabbit" for someone who likes carrots or has big ears, "Beans" for someone whom
you don't want to sit next to in a movie :-> etc.

The last is the "Best" in the eyes of the fighter pilots I know. It is given for a single spectacular incident.

Case in point: Squadron CO is doing a flyby in his F-14 across the beam of his carrier for the movie people on board. As he
starts to pass the ship, he kicks in the burners. Engine explodes and F-14 goes toward the horizen trailing flames and pieces of
airframe. After a little swim, the CO learned he had a new Callsign.

Comet.

Mines not that good, but I like it anyway.

It all starts at Texas A&M University back in the Fall of 84. On campus there was a group of students who formed a student
organization to play wargames. It was known by many names, Gamers, GRAMETS, and finally NOVA. For those of us
involved, it was a time we will never forget (though we often wish everyone else would forget parts of it :->

One night I'm gaming, minding my own business, sitting on the back of a chair, when out of nowhere the thing decided it
didn't like it. Pieces go everywhere and I end up bleeding on the floor. Now you have to understand, I only weighed about
130lbs at this point, and there was no real reason for it to go. But no problem, I stayed all night and quietly bled while playing
SFB and Squad Leader. Now the only thing of note here is that this was the first meeting that Tim "Chuckie" Gray (aka Noid
in ck) ever attended.

The next week, were doing something involving dice again, and someone knocks a handful off on the floor. Several of us get
down to collect them and, almost immediately, the table takes a severe dislike to my being under it. Once again the blood
starts to flow. Tim was also there. His second meeting.

The next week, (and no, I am not toejamting you) Tim shows up and makes some smart comment about whether or not I'm going
to bleed. I laugh it off (silly me). We game for a while and all begin to get hungry. Being a poor college student, I had just
enough money to pay for the burger and drink from the snak bar downstairs.

I, in a typically witless fasion, begin a headlong rush up the stairs to get back before they change the position of any of my
squad. On the final flight of stairs, I, of course, slipped.

Now literally, on the way down to the floor I had time to consider the following facts:

    No matter what I do, this is going to hurt
    I have no money left
    I'm still very hungry
    I'm also very thirsty and need the caffine
    I'm going to lose either the hamburger or coke if I stop myself from falling

So, I thought as I went down:

    Coke or Hamburger
    Coke or Hamburger
    Coke or Hamburger
    FACE (SMACK)

Needless to say, Chuckie was highly amused when I got back to the room, bleeding again. Still have the scar over my right
eye from that one, BUT I saved my DINNER.

I was then awarded the nickname of Ouch, which has unfortunately stuck with me through my entire life.

Ask me sometime about:
 How I tore my rotator cuff in my shoulder turning off a light switch
 How I broke my toe on a blade of grass
 How I broke my thumb falling UP a flight of stairs.

And the list goes on.

Mail me at mtoler@cris.com if you really feel the need.



------------------
Ouch out
------------
For Bug reporting. System:
Celeron 300a oc to 450mhz
Viper 770 (TNT2)
64 meg ram
Sound Blaser 16
gigs and gigs of mp3's... I mean hd space
Logitech cordless Mouseman+ (4 buttons & wheel)
Title: Where did you get your call sign?
Post by: Hamerd on May 02, 2000, 01:55:00 PM
Hamerd is short for Hammerdan, which I had sence 88' when I started playing Paintball  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif) had a real short barrel pumpgun and guys said when I shot at you I hammerd that little gun for all it was worth, so they started calling me hammerdan, which was more of a joke than anything LOL just kind of stuck!!!
Title: Where did you get your call sign?
Post by: Replicant on May 02, 2000, 02:14:00 PM
Awooga

Replicant/Nexx, if you haven't guess are from the film 'Bladerunner'.  I guess it mainly goes back to having a band t-shirt with 'Replicant' written across the front...

If I was to choose a new name it would be 'Moschops'....  UK guys might, might... get it>!?   (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)

'Nexx'
Title: Where did you get your call sign?
Post by: Nash on May 02, 2000, 02:49:00 PM
LOL Ouch! Hysterical.

"Ask me sometime about:

How I tore my rotator cuff in my shoulder turning off a light switch

How I broke my toe on a blade of grass

How I broke my thumb falling UP a flight of stairs.

And the list goes on. Mail me at mtoler@cris.com if you really feel the need."

Fahgedabout email... Post it here!
Title: Where did you get your call sign?
Post by: daddog on May 02, 2000, 05:02:00 PM
Now I know Dan!  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

also

What Nash said.  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

------------------------
daddog
332nd Flying Mongrels (http://www.ropescourse.org/flying.htm)
Snapshots (http://www.ropescourse.org/snapshot.htm)
Title: Where did you get your call sign?
Post by: hitech on May 02, 2000, 05:19:00 PM
My first job out of colage was creating a robot system for making refigurators. The project enginer call my office one day asked to speek with HiTech. The next thing I know everyone at the office is calling me HiTech.



------------------
HiTech
For Bribes (http://www.internetwines.com/pa95154.html)
Title: Where did you get your call sign?
Post by: HARD SCOUT on May 02, 2000, 05:59:00 PM
New here but love this stuff. I see Sundog and Chak and some other FAers have switched over to here.  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

Use to be scoots in FA. I just look like someone named scooter. But scooter was taken so I went by scoots6. Then joined HARD squad as HARD_SCOOTS ( which someone said reminded them of their dog after it takes a dump, LOL ) Then people kept messing up my nick and calling me SCOUT. So after while I realized, I kinda fly like a SCOUT. Sneaky and also like to escort buffs and SCOUT ahead for nmes. Now I am HARD_SCOUT. hdscout in the game AH.

Also have some Cherokee Indian ( not much but enough, heh heh ) in the blood.

Well OK! the REAL story is my girlfriend thought that SCOOTS was a lame nickname and childish so I changed it... LOL  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif))

HARD_SCOUT

------------------
" Its' a dog eat dog world and I'm wearing Milk Bone underwear " ( Normism )
Title: Where did you get your call sign?
Post by: sallie on May 02, 2000, 10:31:00 PM
Well it will PLEASE some of you to know that I am NOT female, some it will sadden,( get ofere it). I am fully MALE,so heavy on the SIR. My work is in aviation, I am an A&P mechanic,(aircraft mechanic), so i recevied a callsighn from my boss "Sassy Sally" becouse i dont work well with others.Hope to see every one and the " get togeather " in the fall   Sally will be there.     Sally of The Lone Wolfs.            
Title: Where did you get your call sign?
Post by: Fenway on May 03, 2000, 01:07:00 AM
 
Quote
Was Grim Reaper in AW3, Callsing was Riper, can only get 5 letters in the box so missed the other P in the name. Couldnt get Ripper in this game was already takin and tried many others, Spent forever to find a name. So The White Sox wone the World Sieres Last year and found that A short callsign was qwicker to typ for 6 calls so took the name Sox.

 White Sox won the series last year? What planet was that on?

 I know we had a cold spell for a bit last year but I don't recall Hell being frozen over when I looked out the window.  (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)

 I know, I know....a Red Sox fan has no right to ridicule anyone concerning World Series victories.

Title: Where did you get your call sign?
Post by: GrinBird on May 03, 2000, 06:46:00 AM
LOL I know that I should get a life, because I DID read all the posts in this long m*f* (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)
Well... a long time ago long before I startet flying Flightsims, I needed an alias because I was active in a lot of newsgroups on the usenet. I had my big green Amazone Parrot walking around on my keyboard (which could make my newsreader do strange things), so I took the name GreenBird after him. 1½ year ago when I startet flying EAW online, I just continued using the name.  
When I signed up for AcesHigh I found out that GreenBird was one letter too long, and took the name GrinBird instead without thinking about it. Later I have found out that its maybe better than GreenBird and consider changing to GrinBird in EAW-community newsgroups and ICQ too.

------------------
GrinBird
Title: Where did you get your call sign?
Post by: daddog on May 03, 2000, 04:46:00 PM
Grinbird you and I might be the only ones to have read this all the way through. I felt obligated, you don't have that excuse.  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)

I also heard that if your post gets to 100 you get a free month of Aces High.  (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)
------------------------
daddog
332nd Flying Mongrels (http://www.ropescourse.org/flying.htm)
Snapshots (http://www.ropescourse.org/snapshot.htm)
Title: Where did you get your call sign?
Post by: Lephturn on May 03, 2000, 05:56:00 PM

I used to race stock-cars semi-pro here in atlantic Canada.  I was on an IRC channel talking with other stock-car drivers and crew about setups for the chassy I was running.  Of course Lefturn was already taken, so I substituted a "ph" for the "f", and "Lephturn" was born.  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)  It kind of stuck, and some of my buddies started calling me that in other things.  When I logged on to Warbirds for the first time way back in 1.01 I already had the handle, and used the 4 letter version of "leph".

Go fast, turn left!  Oink!

------------------
Lephturn - Chief Trainer
A member of The Flying Pigs
Visit Lephturn's Aerodrome for AH news, resources, and training data.
 http://users.andara.com/~sconrad/ (http://users.andara.com/~sconrad/)
(http://tuweb.ucis.dal.ca/~dconrad/ahf/lepht.gif)

"MY P-47 is a pretty good ship
And she took a round coming 'cross the Channel last trip
I was thinking 'bout my baby and lettin' her rip
Always got me through so far
Well they can ship me all over this great big world
But I'll never find nothing like my North End girl
I'm taking her home with me one day, sir
Soon as we win this war"
 - Steve Earl
Title: Where did you get your call sign?
Post by: Sox on May 03, 2000, 06:39:00 PM
Finway your right, It must of been the year before last. I have lost time. Didnt think i have been flying this for that long or maybe now, Thay mite not of even wone at all. LOL, at the time i was wrighting this I was probly drinkin and realy didnt care. The only time im on here is to drink some, shoot some, And have a good O'l time. Hell did not freez over i can asure you that.  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)  
Title: Where did you get your call sign?
Post by: Mathman on May 03, 2000, 10:43:00 PM
Well, i came up with mine when i first got this computer.  I was signing up with an isp and needed an email address.  Well, since I teach math and I am terribly unoriginal, I came up with Mathman.  I ended up using it as my callsign/nick in all the games I play online.

-math
Title: Where did you get your call sign?
Post by: Lethrnek on May 04, 2000, 02:19:00 PM
I came up with mine, a shortened version of Leatherneck, due to the fact that I am a retired Marine Corps Sergeant Major.  I used to use the nick Marine47 but changed it upon coming to AH and joining the VMA111 Devil Dogs.  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)

Semper Fi, do or die.



[This message has been edited by Lethrnek (edited 05-04-2000).]
Title: Where did you get your call sign?
Post by: Ripsnort on July 20, 2000, 09:29:00 AM
And yet  another punt!
Title: Where did you get your call sign?
Post by: daddog on July 20, 2000, 05:10:00 PM

Wooo hooo!  My first post to make it over 100! Thanks Rip! Even if it was just a punt.  (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)
Title: Where did you get your call sign?
Post by: snafu on July 20, 2000, 06:03:00 PM
"S"ituation  "N"ormal  "A"ll  "F"***ED "U"p

AH was my 1st flight sim and I wanted a call sign which was (A) Airforce Related & (B) would reflect my flying until I got better. (I never got any better)

I always planned to switch to "FOKKIT" after Beta but snafu sort of grew on me.
 

TTFN
snafu

------------------
Title: Where did you get your call sign?
Post by: wolf37 on July 20, 2000, 08:11:00 PM
nice post here, i really liked it, and ye i read the whole thing.

mine is not that great, so dont hold your breath, my friends used to call me a wolf when we went to the bar by the way i would prowl around looking for a tasty treat. the 37 was my age when i started playing AH.

wolf37
C.O.
THUNDER BIRDS
Title: Where did you get your call sign?
Post by: SOB on July 20, 2000, 08:52:00 PM
A great group of guys (and gal) from Air Warrior on Delphi gave me my handle when I started supporting the Flight Sim Forum there for Thrusty.  They all knew my dad, and really like him, so I was dubbed  SOB - Son Of Buzz.  Since I was supporting joysticks, I almost got stuck with the handle of Stickboy, which doesn't fit my stature  (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif), but SOB was cast upon me instead.


SOB
"Son Of Buzz", but my squaddies may tell you it means somethin' else!
Title: Where did you get your call sign?
Post by: Gadfly on July 20, 2000, 10:09:00 PM
Walmart
Title: Where did you get your call sign?
Post by: skippy on July 21, 2000, 01:17:00 AM
Crash n burn date called me this when I made myself a PEANUT BUTTER sandwich for dessert instead of eating her 'Baked Alaska', after  a gourmet dinner she spent all day preparing and 2 hours cooking needless to say she never called me again , nor did I bother calling her since her 'Baked Alaska' was runny and yukky anyways.   (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif)
Title: Where did you get your call sign?
Post by: av8or on July 21, 2000, 02:20:00 AM
Well kinda unoriginal but i am a pilot by trade online and in real life so it was to be av8or. It would have been different if i had known we couldn't change it.Also i had to put something down as a callsign (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)
Title: Where did you get your call sign?
Post by: Missile on July 21, 2000, 07:58:00 AM
I came by mine honestly. I was on a Titan II missile crew for over 14 years. (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif) In fact, my biggest claim to fame is that I am 1/4 of the Best Missile Crew in the history of SAC.:cool My evil twin may show up as SNARK....another missile that was pretty much a failure. (http://bbs.hitechcreations.com/smf/Smileys/default/wink.gif)
Title: Where did you get your call sign?
Post by: Downtown on July 21, 2000, 08:48:00 AM
Well I had started online with the alias of "Bad Bad" from the Jim Croce song "Bad Bad Leroy Brown" but my first name isn't Leroy.  When I tried to log into WB as badbad it was already taken, so following the time honored tradition of taking one that others had called me tried dwntwn for "Downtown" which is commonly attached to people with the last name of Brown.  So here I am "Downtown" Lincoln Brown.

How I got my real first name is a much more interesting story.

------------------
(http://www.tir.com/~lkbrown1/dtahcard.gif)
"Downtown" Lincoln Brown.
    lkbrown1@tir.com    
 http://www.tir.com/~lkbrown1 (http://www.tir.com/~lkbrown1)
Wrecking Crews "Drag and Die Guy"
Hals und beinbruch!
Title: Where did you get your call sign?
Post by: Wilfrid on July 21, 2000, 10:13:00 AM
I`m named after my long, stupid Dachshund. Real names Tony.

------------------
"Thats not fair - you can`t compare Macs with Etch-A-Sketch. People LIKE Etch-A-Sketch."
Title: Where did you get your call sign?
Post by: Bluefish on July 21, 2000, 10:21:00 AM
I grew up in New Jersey and surf-fished a lot for bluefish.  Noticed that when pursuing prey they were overly aggressive and not terribly bright (I've seen them run themselves onto the beach and not be able to get back into the water).  It seemed appropriate, somehow.
Title: Where did you get your call sign?
Post by: eskimo on July 22, 2000, 01:31:00 PM
I was born and raised in Alaska.  I have always been fascinated by the natives of Alaska, of which Eskimo's are the most well known.  In WB, callsigns were limited to 6 letters, eskimo had a neat ring, and is easy to remember.  
I also enjoy snacking on raw walrus.

eskimo

Title: Where did you get your call sign?
Post by: Tac on July 22, 2000, 02:09:00 PM
It's short, easy to type, easy to remember and lends itself to a lot of interesting acronyms.

It's also how my machine guns sound...

tactactactactactactactactacta ctactac  (http://bbs.hitechcreations.com/smf/Smileys/default/biggrin.gif)
Title: Where did you get your call sign?
Post by: Rickenbacker on July 23, 2000, 12:39:00 PM
When I first started frequenting various MUSHes (online roleplaying games, all text based) many years ago, I needed a name for my character. I'd just read Eddie Rickenbackers' book and really liked it, so I tried that, and it worked. It's stuck with me ever since, and I'm even thinking about adding it to my real name  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif).

Oh, and I recently heard from Ricks' grandson, and he said it's OK for me to use the name. No, really  (http://bbs.hitechcreations.com/smf/Smileys/default/smile.gif).

Of course the handle is too long to fit in any sim, but I've been -ri-, rick, --ri-- and ricken in WB, and Ricken on AH.


Rickenbacker
Independent Swedish Airforce
Title: Where did you get your call sign?
Post by: MrLars on July 24, 2000, 12:52:00 PM
Back in the 60's I was known as O.D. That nickname stuck with me 'till I went to Nam. We had a real dick for a CO when I first got there and was ordered to tell others to call me something different since my nickname reminded him of all the problems there were with drugs. So I changed it to Lars since it kinda resembles my RL name of Larry. I've used it or a varriation of it <pong only allowed 3 letters> for the past 40 or so years.

MrLars....someone beat me to Lars in AH :-/
Title: Where did you get your call sign?
Post by: Skraut on July 24, 2000, 07:10:00 PM
Ok this is possibly the most painful nickname out there.

This goes all the way back to when Quake came out.  The first time I played, I was trying to come up with a good name.  Everyone else was MeGaKiLLa-DUdE or something else like that.  I was sitting there contemplating in front of my computer, nude (don't ask) eating a giant Bratwurst loaded with hot sauerkraut.  Took a bite, and a bunch of the sauerkraut fell out in my lap.  I ended up with minor burns, a LOT of pain, and a nickname.  Thought it sounded cool as Skraut, and that's what it has been since.
Title: Where did you get your call sign?
Post by: flakbait on July 25, 2000, 12:24:00 PM
Got mine back in Wb 2.70 just after a friend introduced me to it. He had it set up for LAN play H2H so we went at it for an hour or so. He got bored and went online for a bit, and he let me fly. I decided to link up with a flight of B-17s on a bomb run. Not long after I found the bombers I found enemy planes. I dove right in on one, blasted him and pulled up. About that time I see in the radio buffer, and hear over my shoulder "Way to go Flakbait!"..I didn't get it.

About 5 minutes later I'm flying home on a near-empty tank. So I ask the BUFF driver what he meant. He says "When u went dwn after nme fitter ack was shootin. Almost hit you. Evry ack dwn there was firing at u. WTG Flakbait". Turns out my friend was thinking the same thing, so it stuck.

I go by Delta6 online due to the movie Full Metal Jacket. I was going along with a trucker and watching it in the sleeper. He hollers at me and asks if I want to play with his CB. I say sure. About that time you can barely make out "Delta6" in the movie just after the mortars blow as the tanks are advancing. So I get on the horn and say "Delta6 requesting radio check" I'll tell you, going on next to no sleep and loads of coffee sure plays tricks on your voice! I sounded a lot like Barry White. I kinda liked the name so I kept it.


Flakbait
online: Delta6; Homicidal Hummingbirds
Title: Where did you get your call sign?
Post by: Ripsnort on March 22, 2002, 09:25:51 AM
Punt!
Title: Where did you get your call sign?
Post by: CyranoAH on March 22, 2002, 10:37:34 AM
I can't believe I hadn't seen this one yet :)

Cyrano... well, I like the character from Edmond Rostand "Cyrano de Bergerac" (equally able with his sword and with his wits) and I do some fencing (sabre), so there you have it.

No relation whatsoever with nose size ;)

Daniel
Title: Where did you get your call sign?
Post by: muckmaw on March 22, 2002, 10:43:58 AM
Mine started out as something silly. I was signing up for AW and needed a callsign, so I came up with Futher-Mucker. Put a few tequila's in me, and this is how I talk. Needless to say, the name stuck with my drinking buddies. Soon it became "Muck" for short.

Now I find myself with my plane nose down in the muck more often than I like to admit, so it works for me.  

Obviously, the MAW at the end is my squad, hence MUCKMAW
Title: Where did you get your call sign?
Post by: save on March 22, 2002, 10:58:10 AM
In WB 1.09 I had to change my id
from "kaka" to something. ( kaka btw is
cookie in swedish) because of creditcard
issues

The day before I saved a # of purple friends butt by hovering over own field
and diving down to save my chased friends. I saved them and as a consequence my new callsign became
save later -save- and now =save= in
warbirds. Unfortunately I havent been flying much here in AH, but save is my callsign here.
Title: Where did you get your call sign?
Post by: FDisk on March 22, 2002, 11:03:01 AM
*sigh*

Where did you dig this one up?

ok, FDisk come from about 15 years back when me and 3 friends started using DOS and we thought we where cool and each picked a utility.

Roo455 in the arena
"Roo" came from Kanga and roo in winnie the pooh. My cousin's 4 year ols had a winnie the pooh game that we still play (she's 5 now) the 455 is my street address. I moved to toronto and that's why it changed from Roo2104
Title: Where did you get your call sign?
Post by: Raubvogel on March 22, 2002, 11:03:38 AM
Hmm..thought I did this already.....

Raubvogel.....German for "Robbery Bird"....its a general salamander of a bird that flies around stealing other birds' food and blindsiding defenseless animals.
Title: Where did you get your call sign?
Post by: Wlfgng on March 22, 2002, 11:09:49 AM
I liked the name.. it's my drummer, or was.
and I dig German prop planes.
Title: Where did you get your call sign?
Post by: Furious on March 22, 2002, 11:10:52 AM
This thread is really pissing me off!!


I have poor temper control.  What some would see as a character flaw, I wear as a badge of pride.



F.
Title: Where did you get your call sign?
Post by: loser on March 22, 2002, 11:41:10 AM
well..... let me see here.  

being at that bar star and catting age, i loath the guys who attempt to swoon the ladies with their stories of granduer and the "yeah i pretty much rock and my whatever is soo big" attitude.

myself i use the "im a total tard idiot" approach. I cant count the number of times some girl has said "you seem pretty nice..." and i just blurt out: "wow you are a poor judge of character, im actually a total loser" works every time ;)

long and slightly ironic explanation aside, i was trying to think of a callsign after more than a dozen beer when i signed up. "loser111" it was.

I actually wanted to use my nick from a certain first person shooter game but "BigdaddyWeenuts" was too long. :D
Title: Where did you get your call sign?
Post by: dfl8rms on March 22, 2002, 12:09:07 PM
Original AH squad formed by Swruchn and "thetick" was "civic minded 5 - 3",  When I joined kept the "Tick" theme and went with:

Die Fledermaus-  The avant-gard of super-heroeness, he's more of a passive crime-fighter, opting to point the direction of the villians to the City's fine police.  Die Fledermaus is German for "The Bat", and he certainly lives up to his 'creature of the night' image.  He's got a real boss utility belt, too!

Squad grew so we formed the "Flying Whirlpool of Suck" -- a spin on a phrase one of our senior leadership team used in a financial presentation:  Always good to have a senior company representative say things like "whirlpool of suck" while talking about financial items. :D
Title: Where did you get your call sign?
Post by: TheTick on March 22, 2002, 12:17:27 PM
Hey dfl8rms!

Let's see...I chose mine in 1995, after becoming a fanatical follower of the then-new FoxAnimation series "The Tick".

So, why did I chose to fly with that name?

Like I said, it was 1995, and I was on the "Confirmed Kill" open beta (ah...the times we had...but I digress).  IIRC, the CK limit was four characters, so I chose "Tick".  It's stuck ever since.

What...you expected more?  It's a freakin callsign.  It don't get more exciting than this!

:p
Title: Where did you get your call sign?
Post by: Biggles on March 22, 2002, 12:40:16 PM
My call sign is AlgyFT (the FT is for the original Flying Tigers, the squad I'm in). I got the Algy part from the series of Biggles books by the British author, W.E. Johns. I have 76 of the books, and am just a few titles short of having the entire collection. I started collecting them when I lived over in England. Here is a very good web site dedicated to W.E. Johns and Biggles. Worth a look!

http://www.penrithcity.nsw.gov.au/usrpages/collect/captain.htm

Now, if we could only get a Ginger, Bertie, Biggles, and Von Stalhein in AH we'd have the whole gang!
Title: Where did you get your call sign?
Post by: w00lie on March 22, 2002, 01:08:45 PM
Mine is from my last name
Todd Woolever

aka w00lie
Title: Where did you get your call sign?
Post by: Kronos on March 22, 2002, 01:10:08 PM
Kronos    ....    

I was card-- in warbirds cause it was my first online sim and i was typing my password in the gameID block....  pretty stupid.

So when I switched over to Aces High I wanted something a little better.  Kronos is known for many things.

Q'onos - Klingon homeworld
Cronos - Greek mythological figure
Kronos(sp?)  - The bear that keeps time in the cartoon "Johnny Bravo"

Well, I watch Star Trek, have been a fan of Greek mythology since I was a kid, and how else would I know that stupid bear???:rolleyes:

Although recently around work I've been known by the nickname "Tex".   Seems on one of my last TDY's I got drunk in the enlisted club during country night and started singing "All my ex's live in Texas" at the top of my lungs.  For about 45 minutes.

And I hate country music.
Title: Where did you get your call sign?
Post by: Vector on March 22, 2002, 01:26:25 PM
Carrier Transicold :)
Title: Florence & Zebedee!
Post by: Flossy on March 22, 2002, 01:26:28 PM
Well, I was originally Flos in Air Warrior when I first started playing there nearly 4 years ago.  We were restricted to 5 characters and I first tried for Floss, but it was already taken.   Floss was supposed to be short for the handle I had chosen of Florence;  I didn't particularly want Flo as it reminded me of the buxom cartoon wife of Andy Capp, with her arms folded and holding a rolling-pin!  Not the sort of image I wanted!  :)  I tried Flos and that was accepted.  

I had chosen Florence as a handle because I wanted something associated with my husband's handle of Zebedee (Zeb for short).  Zebedee was a character from a 70's cult cartoon series here in the UK called "The Magic Roundabout" (http://www.zeb.clara.net/magic.htm)  - a five-minute program which used to be aired immediately before the early evening news, guaranteeing a big audience.... so popular was it, that people would stop what they were doing to watch it.  Zebedee bounced around on a large spring, being the lower half of his body, announcing to everyone that it was "time for bed".  My husband chose this name, partly because of the way he kept "bouncing back" to Air Warrior (he used to be Rusty) and also because of the way he landed one of his favourite rides, the P38 - always bouncing several times down the runway.

I had been watching Zeb play for about 6 months before starting my own account, and Flos was born.  In Aces High, I was Flos when I first tried the game, but of course it was unavailable when I returned nearly a year ago.... I could have asked for it back, but by then was often referring to myself as Flossy anyway, so decided to use Flossy instead and have been Flossy ever since.  :)

(http://www.flos.clara.net/storage/floszeb.jpg)
Title: Where did you get your call sign?
Post by: Vector on March 22, 2002, 01:33:18 PM
Quote
Originally posted by Kronos
Kronos(sp?)  


Oh, you can't spell your handle? :D
Title: Where did you get your call sign?
Post by: Sikboy on March 22, 2002, 01:46:06 PM
I saw a comercial for the movie Van Wilder, and I thought I'd launch a preemptive campaign to say that my handle has NOTHING to do with either that movie or Trainspoters which aparantly also had a guy called sickboy in it. My handle comes from my favorite band; Social Distortion. They had a song called "Sick Boy." I wanted "Sickboy" for my liscense plate, but some other California Nesshead had beat me to it (perhaps had I lived in Nevada. Hmmmm...) Anyhow, All I could get was "Sikboy" so I took it. Thought I was 10 pounds of cool in a five pound sack when I was 19. Its a bit harder to explain to people 10 years later.

-Sikboy
Title: Where did you get your call sign?
Post by: JoeDirt on March 22, 2002, 01:58:49 PM
i wanted a name everyone could say easily....... and remember.....
and the movie joedirt came to mind.....and he liked explosives and so do i so....(ive never really seen the movie tho. just heard of it)

some people mix me up with JoeCrip :(
Title: Where did you get your call sign?
Post by: Airscrew on March 22, 2002, 02:16:26 PM
Ok, I'l try to keep this short.

          BBS is MajTom (David Bowie) but I fly under AirScrew.   When I first signed up I had wanted  to use the nickname I had for long time from Mountain Home AFB, Trigger (long story about that one, lets just say it involves a M16 and a portajohn).  
Then I tried MajTom but it was already taken, so I tried Maj Disaster but too long or else someone already had that too.  Finally got MajWreak, thought that would be cool.  After my two weeks were up I messed up the account and had to pick another name.  
I was a dental tech for 20 years in the USAF. One of my many additional duties was Flight Dentistry NCO, I worked with the Flight Medicine guys to schedule pilots dental exams and work around the flying and training schedules. Anyway we always referred to the pilots as Wingnuts and Airscrews. Wingnuts was taken already and also Propnut and Propwash.  So I settled on AirScrew.
Title: Where did you get your call sign?
Post by: loser on March 22, 2002, 02:27:26 PM
Quote
Originally posted by Sikboy
I saw a comercial for the movie Van Wilder, and I thought I'd launch a preemptive campaign to say that my handle has NOTHING to do with either that movie or Trainspoters which aparantly also had a guy called sickboy in it. My handle comes from my favorite band; Social Distortion. They had a song called "Sick Boy." I wanted "Sickboy" for my liscense plate, but some other California Nesshead had beat me to it (perhaps had I lived in Nevada. Hmmmm...) Anyhow, All I could get was "Sikboy" so I took it. Thought I was 10 pounds of cool in a five pound sack when I was 19. Its a bit harder to explain to people 10 years later.

-Sikboy


why not:  kingofools ?:D
Title: Where did you get your call sign?
Post by: Hajo on March 22, 2002, 02:39:08 PM
Hajo

Hans Joachim Hermann was leader of the JG/300 Wilde Sau which flew 109s and 190s in defense of the Reich.  Stold his nickname which was "Hajo"
Title: Where did you get your call sign?
Post by: SKurj on March 22, 2002, 02:51:46 PM
Scourge as in of the skies +) hehe boring whatever I know...

AW only permitted 5 characters


SKurj
Title: Where did you get your call sign?
Post by: Maverick on March 22, 2002, 02:59:07 PM
Picked mine as it described me well. I have always been a lone wolf type person and it suited. The 13 came from the 13th TAS  squad that I was a member of all the way back to 93 in AW.
 No it wasn't from the Tom Cruz movie, it was the older western serial tv show of the same name.
Title: Where did you get your call sign?
Post by: Sikboy on March 22, 2002, 03:11:58 PM
Quote
Originally posted by loser


why not:  kingofools ?:D


lol, only 7 letters on a CA License plate :)
I'm partial to "Mommies Little Monster" and considered a change, but there was an -MLM- in AW already lol.

-Sikboy
Title: Where did you get your call sign?
Post by: RangerBob on March 22, 2002, 03:35:30 PM
Enjoying this thread and the answers to all the questions I had like...hmmm wonder what that name relates to????


RangrBob... is easy to figure out. I'm and old Army Ranger from the Vietnam days. Once and Army Ranger...you're a Ranger for life. I've been called Ranger Bob ever since those days. My call sign on all sims has been some form of RangerBob. My Ranger buddy is know as Ranger Finn. You either took the first name or the last name. Whatever fits.

Ranger Bob
Title: Where did you get your call sign?
Post by: steely07 on March 22, 2002, 04:03:39 PM
Mine kinda developed from my name too,first name is Neil,surname starts with J and my friends called me neilj,then neilyj,then steelyj,then just plain steely,sort of an evolution thing i spose :)
Title: Where did you get your call sign?
Post by: Dawggus on March 22, 2002, 04:26:35 PM
BFD ...

I started playing Air Warrior at the end of the baseball season.  We had gotten in the habit that year of saying, when our 3, 4 and 5 hitters were coming to the plate, "time to let the Big Dawg eat".  So, I used the handle "Big Dawg" when I started, and shortened it to BFD for my CPID.

So, what's the "F" stand for?  Hmm, the world may never know :).

Cya Up!
Title: Where did you get your call sign?
Post by: Juan Carlos on March 22, 2002, 04:28:42 PM
mi nick in WBs was wyrm, witch means winged serpent, but by the time i switched to AH wyrm was allready taken and i didn´t want to ad a number or anything to it, so since i only fly german planes i put sinonyms in a english to german translator, and dragon = drache, serpent = schlange, etc.. so my account with drache got screwed up and now i´m schlange.
Title: Where did you get your call sign?
Post by: Ratbo on March 22, 2002, 06:09:33 PM
Westy's handle is just a spinoff on his last name.  Now "Rancid" that's a story. :p

-W


Quote
Originally posted by Westy
Oh great! Um? Westy huh? <looks down depressed>
 ferRrget it. There is no story. What a lame handle hmmm? How about?   "Toxic" !!!???

 (sick of 'Westy'. considering a new one now that everyone has even a minimal story behind their handle)

    -- (fill in the blank for now)  
Title: Where did you get your call sign?
Post by: Ratbo on March 22, 2002, 06:23:10 PM
OK - I'll bite.

For most of my AW career I went by =B17= , I took it when I was new and it was a just a lamer use of my favorite plane. But I really couldn't get out from under it becuse I had become a fairly well known player.

The AW Longbow scenario had a "real life" kinda newsgroup that would have become like our Bigweek NG except we already had that. During this scenario I was suffering from a rat infestation and going on a mad killing spree. This culminated in a couple of bloody battles and a post from me in that NG entitled "I HATE RODENTIA!!!!" that chronicled the two most vicious battles.

I signed it "Ratbo" - this was the first recorded use of the term.

Then 3rdUp called "RATS AWAY!" on the next frame when we dropped our eggs - on the open channel no less.

Then I used Ratbo on my AW "shades account" and finally used it on my name tag at the final AW Con in Seattle. When it came time to pick a name here, it seemed a no brainer as most of the old AW types knew who Ratbo was and the people I'd meet here wouldn't care that I kinda changed my name 'cause they didn't know me anyway - so the transformation was complete.

However my e-mail is still b17ofthebz@hotmail.com and prolly will be forever.

There you have it!  (and that's the *short* version) :)
Title: Where did you get your call sign?
Post by: NUTTZ on March 22, 2002, 06:52:38 PM
You really don't wanna know


NUTTZ
Title: Where did you get your call sign?
Post by: Thorns on March 22, 2002, 07:50:14 PM
Thorns = My last name is a flower, and it has thorns on the stem.
Title: Where did you get your call sign?
Post by: SirLoin on March 22, 2002, 08:25:58 PM
Mine comes from a character in an episode of Bugs Bunny...Sir Loin of Beef.

Makes a nice acronym too..
Title: Where did you get your call sign?
Post by: blutic on March 22, 2002, 08:36:20 PM
It had to be a dog. A lazy, good for nothing hound that was as  smart as it was hard headed :D
So far I'm still working on the smart part:p

Blutik
Title: Where did you get your call sign?
Post by: Vruth on March 22, 2002, 09:06:43 PM
It's an old latin phrase us/army sigs guys used to have. It means:

Volo Regno Ursi Tactu Honeste

Fly with Speed
Be supreme over all
Lead
Be silent
Honour

Just in case you were wondering...
Title: Where did you get your call sign?
Post by: Pollock on March 22, 2002, 09:17:37 PM
Pollock, not the fish but the ethnicity.  I was always called it in high school. Proud of it!
Title: Where did you get your call sign?
Post by: N1kPaz on March 22, 2002, 09:45:57 PM
Well I used to play alot of Steel Panthers III. I just loved being the Russians. At the end of each turn the names of the troop leaders who successfully rally are flashed on the screen. One was named Zapkin. I liked it. Lt. Zapkin or something. For some reason I just liked it. Weird isnt it? Maybe i was a zapkin in a former life????
Title: Where did you get your call sign?
Post by: SAR on March 22, 2002, 10:16:07 PM
My call sign stands for Search And Rescue.

It's what I do on my spare time when I am not spending time with my wife and son, working or playing AH.
Title: Where did you get your call sign?
Post by: Widewing on March 22, 2002, 10:31:19 PM
From Widewing Publications (aviation publishing), owned by my friend and occasional co-writer, Warren Bodie.

My regards,

Widewing
(aka C.C. Jordan)
Title: Where did you get your call sign?
Post by: LoneStarBuckeye on March 22, 2002, 10:38:47 PM
I am attorney, and "JNOV" is a latin acronym used in the law.  Roughly translated, it means "justice notwithstanding the verdict."
Title: Where did you get your call sign?
Post by: Thunder on March 22, 2002, 11:13:39 PM
I used to race motorcycles back in the early 70's and my racing buddies gave me the nickname.

"Thunder"
Title: Where did you get your call sign?
Post by: majic on March 23, 2002, 12:12:46 AM
my initials are m j c .....
Title: Where did you get your call sign?
Post by: BUG_EAF322 on March 23, 2002, 12:47:12 AM
Because i drive a pre war car that still goes on
this one i drive :

73' version vw1303

field modification :1600 cylinderset
                             angle w camshafts 276
                             k&n airfilter
                             lightened flywheel
                                                         
estimate around 60 hps :D

it's the best wabble around
not to uber but good cornering

BUG the nickname used for beetles
Title: Where did you get your call sign?
Post by: pbirmingham on March 23, 2002, 02:02:55 AM
Back in 1996, I bought the boxed AW from a used SW store.  I flew a lot against the drone fighters, but usually found myself at equal energy and running away from the drones.

When I signed up for AW in early 1997, I chose the name Runs From Drones (analagous to Dances With Wolves.)  Since there was a five-character limit for the in-flight ID, I chose Runny.

In Feb 1997, when I joined the Skull Squadron, there wasn't enough room for Runs From Drones ^Skull^, so I just became Runny.

I'm a Shill instead of a Skull, but I am still Runny.  Every once in a while I think of using my Quake/Half-Life name of Killbilly, but I pretty much stick with Runny.
Title: Where did you get your call sign?
Post by: Dennis on March 23, 2002, 02:18:20 AM
There was a movie a few years back called "The Final Countdown." It was about a nuclear-powered carrier getting caught in a timewarp back to Dec. 6, 1941.  At one point a pair of patroling F-14s go after a couple of Japanese fighters straffing a yacht.  One of the fighter jocks says "splash one Zero" when he shoots down the first one.  

Hence, Splash1.

Now if I could just shoot down a Zeke.....
Title: Where did you get your call sign?
Post by: Swanie on March 23, 2002, 02:26:19 AM
My name is TJ Stocks every time I showed up to work they called me TJSwan after the cheap wine over the years it just became Swanie
Title: Where did you get your call sign?
Post by: ZXMAW on March 23, 2002, 03:27:59 AM
My first bike was a 750s V-4 Saber by Honda, was a great Bike. Then GSXR-750 for a few days.... hated it.

ZX-10 By Kawasaki, then found a bunch of guys who liked to ride together and most of us had KAW ZX products so  we were called ZX'ers.  Some of the guys got the tattoo's we liked the name so much. There are only 4 of us left alive today. Only 1 of them died in a motorcycle accident. I crashed my bike with a brand new pair of leathers and never got a new one for some reason. I don't know why exactly but every sping I say the same thing "I want to ride again!"
Title: Where did you get your call sign?
Post by: Bonden on March 23, 2002, 06:05:20 AM
Good Thread!

Started out as "centurion(1)", (my girlfriends nickname for me), in FA1.5. Used "animal1945" (couple of old girlfriends used to refer to me as such - and added birth year) for a bit in FA1.5 also.

Began AH as Elguapo in June or July, but this caused confusion when Elguapo1 came back on the scene. Not wanting to damage his credibility in AH, changed name to Bonden last fall.

I think only Osage and Pongo really know where this one came from.

   :D
Title: Where did you get your call sign?
Post by: Witless on March 23, 2002, 06:45:53 AM
Arf!

My online id is Trikky, Tricky being taken. My real name is Richard, family call me Rick, friends call me Tricky or Trickster because when the wolves are circling, I can be a little bit devious.

Very dull compared to some, wtg Ouch :)
Title: Where did you get your call sign?
Post by: Wulfmen on March 23, 2002, 10:41:04 AM
My Family-Name is Wolf
In germany the Wolf (English Wulf), had many Nicknames, one of those is "ede".
ede comes from ede-Wolf and its fom the gebrüder Grimm.
This is my Nickname over 25 Years now.


i was ede in AW, WB and Ego-Shooters.

greets
ede
Black Adders
Title: Where did you get your call sign?
Post by: Big Mac on March 23, 2002, 11:08:54 AM
A guy who worked for me would come into my office everyday and call me, Big Mac.  It is derived from my last name.  I have been using it since AW.  

I can't tell how many people have asked if I work for McDonalds, btw, I don't.   I have heard all the jokes, "I can't believe I got shot down by a hamburger," or if I get killed, I hear, " I would like some fries with that Big Mac."
Title: Where did you get your call sign?
Post by: CAV on March 23, 2002, 05:56:47 PM
Hi

I be came CAV.... as in U.S. Cavalry... when I first started playing AW on AOL back in 1996.

It was CAV because I was a 19D Cavalry Scout in the Army. That was the good old days, now I am retired from the Army (22yrs) and have to work for a living...

CAV
Title: Where did you get your call sign?
Post by: hitech on March 23, 2002, 06:01:02 PM
First job out of collage, a customer I had been working with on a job sight, calls in and ask for HiTech.

It stuck.
Title: Where did you get your call sign?
Post by: sax on March 23, 2002, 08:45:48 PM
Good thing he didn't ask for the Putz:)

Love sax music and playing AH. Figured I might as well combine the two.
Title: Where did you get your call sign?
Post by: Tub-o-lard on March 24, 2002, 01:44:19 AM
I discovered a meal between breakfast and brunch
Title: Where did you get your call sign?
Post by: ZeroPing on March 24, 2002, 02:17:53 AM
I used to be in a HL squad (CS) and the server you played on was VERY close to my house, but it wasnt my server. I had the best ping EVERY time we played....... and once we were all high and i had like 2 ping(lowest number better) they started calling me names and one said ZeroPing so i picked it
Title: Where did you get your call sign?
Post by: mrsid2 on March 24, 2002, 02:39:43 AM
When I originally started playing warbirds, I thought of taking the nickname of the top finnish ace in ww2. Then after consideration though I thought it would be blasphemy and decided to switch to something else.

On the first login screen I had no idea I'd be stuck with the nick I choose forever so I just slapped mrsidley - which was cut to mrsidl and I flew with that name for several months.

People who later got bored being shot down repeatedly started calling me mrs idl.. :)

When I moved to AH I saw an advertisement for the movie 'the talented Mr Ripley' and I hoped the name would be an omen - no such luck though.
Title: Where did you get your call sign?
Post by: mipoikel on March 24, 2002, 03:11:30 AM
My real name is Mikko Poikela and gameid mipoikel

Ive thought to change it to MIP. Thats what all are using now..:D
Title: Where did you get your call sign?
Post by: Durr on March 24, 2002, 01:05:56 PM
Durr is my last name.  I tried getting some of the callsigns and nicknames that I have had in real life but they were all taken, such as:

Tex-- When I first left home I went to Illinois.  Because I drove around in a 4x4, wore boots, a leather belt with buckle, and a hat (yes ripsnort I earned mine) all the Yankees up there called me Tex.  I am actually from Louisiana, but to them anybody that wore a cowboy hat and boots was from Texas.  Besides I figured that if I protested to much about being from Louisiana (a much superior state ;)  ) they might start calling me Louise!

Farmer-- Later, when I returned to Louisiana and started college at Louisiana Tech University, I joined AFROTC.  I was in the honor guard and everybody in the honor guard had a nickname.  Mine was Farmer, because I had an incredible farmers tan on my arms, from several years of raking hay on a open topped tractor with my sleeves rolled up.  The colors have evened out some now, but at the time it was like, major tan below the elbow and pasty white above.  

Sleepy-- After I was commissioned 2lt in the USAF, I was sent to Navy Air Station Pensacola to flight school to become a strike navigator.  Everybody in the military aviation community quickly acquires a starter  callsign which may or may not stick, until they do something truly memorable which guarantees them a nickname for life.  Initially,  I was dubbed Sleepy because I fell asleep in a particularly long ground school class (I wasnt the only one, lots of nicknames were given that day for the same reason like Sandman etc.)  That nickname didnt stick very long because it doesnt fit me very well.  Im almost finished with flight school, (will get winged in August or Sept) and have managed to avoid getting a permanant callsign so far.  If and when I get tagged with one for real, and its only one stupid mistake away, I will probably change my AH callsign.
Title: Where did you get your call sign?
Post by: thrila on March 24, 2002, 01:39:33 PM
Well my nickname back at college was thriller (we all know the song:D ) due to my name being similar to michael jackson.  

When i first started playing RS i was known as thrilla killa (i wanted to sound like a double hard B$%$"&D....heheh).  Overtime it shortened to just thrilla- and once more to just thrila as i'm now known today.
Title: Drunky is Yknurd spelled backwards
Post by: Drunky on March 24, 2002, 04:14:05 PM
Mine is easy to 'splain...

I'm usually thinking of drinking, drinking or drunk while playing :p

Always a twelve pack of Bud Light next to my desk while I'm flying.
Title: Where did you get your call sign?
Post by: Slayer on March 24, 2002, 08:03:25 PM
started playing aw as slaye cause slayer was taken. back in 95. was a CB handle that was givin to me by a friend. I was a big hippy as a teenager and listend to that heavy metal stuff
Title: Where did you get your call sign?
Post by: VAQ on March 24, 2002, 08:25:54 PM
United States Naval Aviation squadron designation

V  Fixed wing
A  Attack
Q  Electronic Warfare (Countermeasures)

Callsign from Tactical Electronic Warfare Squadron 131 (the VAQ-131 "Lancers"), my old USN squad.  Seemed an appropriate callsign for Aces High.


vaq
Title: Where did you get your call sign?
Post by: Xjazz on March 25, 2002, 04:37:32 AM
I start flight sims with Su-27 Flanker 1.*.
That time many pilots had names like "Super killer", "deathabove" etc "idonthaveahardonwithoutpc" stuff.

I choise a "Name" which aint means nothing.
Title: Where did you get your call sign?
Post by: MANDOBLE on March 25, 2002, 06:04:50 AM
MANDOBLE: the most inefficient spanish sword ever made, unless you were a giant. The medieval equivalent to a 190 ;)
Title: Where did you get your call sign?
Post by: BNM on March 25, 2002, 06:18:16 AM
Played AW about 5 yrs. since back in 95. I started playing WWIIO back in June 2001. I had a cool CPID 'Sdwndr' short for sidewinder when I started in AW. I joined the Brewster Buffalos and they got tired of trying to type it in battle. I went out and changed it to bnm. There is nothing easier to type in battle "try it"! I've used BNM in every online game I've played since 95. Of course if anyone asks I just tell them it stands for Big Nasty Mutha. ;)

BNM
Brewster Buffalos
Title: Where did you get your call sign?
Post by: Mark Luper on March 25, 2002, 06:19:15 AM
Had the opportunity to get in on the latter days of Alpha testing in AH. My call sign was Mark then, my middle name, the one I use most.

When the program went to open beta, myself and many others of the Alpha team added "AT" to the back of their call signs so people would know who to ask for information and help. Hence: MarkAT.

Decided to keep it :)
Title: Re: Where did you get your call sign?
Post by: Blue Mako on March 25, 2002, 08:16:41 PM
I SCUBA dive and have a fascination with sharks so I thought it would be cool to have a nick that involved them.  The Mako shark is a cousing to the Great White and is dangerous (one of the few that will attack without provocation) and it is also called the "Blue Pointer" so I combined the two names and got "Blue Mako" (BLUEmako and soon to be BLUmako2 when I return to subscribing).
Title: Where did you get your call sign?
Post by: Kweassa on March 25, 2002, 09:28:54 PM
I forgot.

 But I have two theories on how I got my callsign.
 
 1) Kwea -Ssa: Pronounced 'kwee - sa', is two Chinese letters meaning "turtle" and a "snake".. referring to a traditional mythical creature named "Hyun-moo" I was fascinated with when I was young of age. The "Hyun-moo" is considered to be a defender of the northern direction, and was frequently drawn with other three sacred creatures of the directions known as the "four godly creatures" on the walls of ancient tombs. I remember seeing a picture of an archaeological discovery of the 'Hyun-moo' drawing when I was 14 years old - a turtle-like creature which had two long-necked heads, a snake and a turtle combined. So I decided I'd be known as 'Kweassa' in any sort of community where I needed either an ID or a knickname.

 2) kweassa: Re-arranged, it spells "weak ass".

 ...

 Judging by how the folks shake the stabs off of my tail lately with their god-forbidden 20mms, I say the second theory is more likely.
Title: Where did you get your call sign?
Post by: Octavius on March 25, 2002, 10:12:40 PM
thought I did this already! :mad:


Dweebed around in AOL-Air Warrior with a mouse first...

First callsign :  Maz (short nick from last name "Masarik")

Maz carried over to Aces High around tour 2 or 3...  

Then:  Executor (stole it from a buddy of mine who does not fly AH :))

THEN:  Octavius (i really dont know why... perhaps I was reading something about the Roman Empire at the time)

then!!:  oct... (because I was too lazy to e-mail Ronni and have it changed)

nothing spectacular :P
Title: Where did you get your call sign?
Post by: KroBaar on March 25, 2002, 10:49:03 PM
My call sign isn't anything spectacular.  My real nick name is Vern (for various reasons) but that name is too common.  Everyone always has it taken and I didn't want to add just random numbers to the end.  
So I decided to try and think of a unique name that had a unique spelling.  For some reason the thought of a crowbar entered my mind, so I came up with a unique spelling of KroBaar, I was sure that no one else would have that.  It is supposed to be Kro'Baar w/ apostrophe, but most places don't accept apostrophes, so I've been going w/o.
I've been using this nickname for online forums for a couple of years now, though this is my first online flight sim.  :)
Title: Where did you get your call sign?
Post by: -Concho- on March 25, 2002, 11:12:51 PM
...after a river North of here.
Title: Where did you get your call sign?
Post by: Sandman on March 25, 2002, 11:20:05 PM
Found it in one of these boxes:

(http://members.aol.com/Alphabet26/CJbox.jpg)
Title: Re: Where did you get your call sign?
Post by: Alucard_II on February 03, 2015, 03:26:53 PM
My callsign in-game is Ikaros.
Its my favorite main character from the show Sora no Otoshimono (Heaven's Lost Property)
Shes an Angeloid, which is half Angel, half Android.
I chose it because she flys alot, and I like flying games so...

Oh yea, she can fly at mach 27, and has a bow that fire arrows with nuclear warheads, pretty op  :angel:
Title: Re: Where did you get your call sign?
Post by: WWhiskey on February 03, 2015, 03:32:10 PM
On a Bottle!
Title: Re: Where did you get your call sign?
Post by: The Fugitive on February 03, 2015, 03:44:51 PM
WOW! almost a 13 year bump! Is that a record?
Title: Re: Where did you get your call sign?
Post by: jeep00 on February 03, 2015, 04:34:34 PM
(http://i1111.photobucket.com/albums/h463/NOAHVT/Woodstock/10615864_10152387179186925_980973156_n_zps891c9b5d.jpg)
Title: Re: Where did you get your call sign?
Post by: -ammo- on February 03, 2015, 04:43:54 PM
(http://i1111.photobucket.com/albums/h463/NOAHVT/Woodstock/10615864_10152387179186925_980973156_n_zps891c9b5d.jpg)

Nice photo, but I'm curious why the right front tire (directional) is installed assbackwards?
Title: Re: Where did you get your call sign?
Post by: -ammo- on February 03, 2015, 04:45:29 PM
Daddog was my first CO in AH and not only do I miss James, the AH community is less for his absence
Title: Re: Where did you get your call sign?
Post by: Dragon Tamer on February 03, 2015, 04:45:43 PM
I love when these dead threads come back to life. It lets me see what was going on before my time.

My callsign in-game is Ikaros.

This post threw me for a loop for a second... I've seen the show but don't remember it being 13 years old...

Edit:

I have a question, it starts on page 2 of this thread. Why are there some members that have a name on the left hand side but nothing else? Is it a server hiccup?
Title: Re: Where did you get your call sign?
Post by: JimmyD3 on February 03, 2015, 05:10:02 PM
Kenai77, Kenai Alaska, Moved there in 1977 with my wife and oldest son (2 years old at the time). We bought our first house there, I was working on the Trans Alaska Pipeline week on/week off. Had 3 more kids and raised them all there, good memories and good times. Moved back to Texas in 1996 to help take care of my parents. It is pronounced Key-Nigh  :aok
Title: Re: Where did you get your call sign?
Post by: Lusche on February 03, 2015, 05:13:47 PM
I have a question, it starts on page 2 of this thread. Why are there some members that have a name on the left hand side but nothing else? Is it a server hiccup?


Look at the dates they posted. This is a necrobump thread that has rested for more than a dozen years, those folks you mentioned never had been a member of this BBS.
Title: Re: Where did you get your call sign?
Post by: Dragon Tamer on February 03, 2015, 05:22:20 PM

Look at the dates they posted. This is a necrobump thread that has rested for more than a dozen years, those folks you mentioned never had been a member of this BBS.

I see, I didn't know that the BBs went through any sort of change over the years.
Title: Re: Where did you get your call sign?
Post by: WWhiskey on February 03, 2015, 05:23:38 PM


I have a question, it starts on page 2 of this thread. Why are there some members that have a name on the left hand side but nothing else? Is it a server hiccup?
Y2K.   :noid
Title: Re: Where did you get your call sign?
Post by: Dragon Tamer on February 03, 2015, 05:30:28 PM
I see.

 :noid
Title: Re: Where did you get your call sign?
Post by: jeep00 on February 03, 2015, 06:50:46 PM
Nice photo, but I'm curious why the right front tire (directional) is installed assbackwards?

Thanks it was a fun day, winched several times.  :aok
As to the tires, they are Goodyear Wrangler MT/R's, and are an asymmetric tread design. They are "best" when the larger lugs are mounted to the outside. But they do look directional and therefor a bit off.
Title: Re: Where did you get your call sign?
Post by: ebfd11 on February 03, 2015, 10:00:44 PM
I took my call sign from the way I fly... aka Lawndart and I dont care who I crash in front of.. I have fun here on AH..


LawnDart
Title: Re: Where did you get your call sign?
Post by: glzsqd on February 03, 2015, 10:04:33 PM
I promise you! the place where I get my call signs is not a sanitary one...
Title: Re: Where did you get your call sign?
Post by: Someguy63 on February 03, 2015, 10:20:41 PM
I wonder where the hell DrBone got his from. :O


I just chose mine cause it sounds cool lol
Title: Re: Where did you get your call sign?
Post by: JOACH1M on February 03, 2015, 10:42:36 PM
My last name was taken... so i put a 1 in it and made it all caps lol
Title: Re: Where did you get your call sign?
Post by: USRanger on February 03, 2015, 10:45:02 PM
                                                                :angel:

(http://s9.postimg.org/bag168hgf/246915_408414445887303_1619347940_n.jpg) (http://postimage.org/)


Title: Re: Where did you get your call sign?
Post by: FLS on February 03, 2015, 11:31:25 PM
Awesome picture.
Title: Re: Where did you get your call sign?
Post by: Reaper90 on February 03, 2015, 11:41:35 PM
                                                                :angel:

(http://s9.postimg.org/bag168hgf/246915_408414445887303_1619347940_n.jpg) (http://postimage.org/)





that plane flying backwards?
Title: Re: Where did you get your call sign?
Post by: JunkyII on February 03, 2015, 11:56:04 PM
My last name was taken... so i put a 1 in it and made it all caps lol

Don't Lie, your real name is Johnny Chimpo :aok

EDIT:
Got my name because I USED TO LOVEEEEE DRUGS WOOOOOOOOOOOOOOOOOOOOOOOOOOOO T
Title: Re: Where did you get your call sign?
Post by: Lab Rat 3947 on February 04, 2015, 12:45:49 AM
My parents met in 1943 on the P-38 assemblyline at Lockheed, in Burbank.
I only fly the three variants of the Lightning.
My last name is Ryder.
I took it a step further with my noseart. My 38 is called Devil Doll.  :devil   Its Bettie Page as a devil, riding a green lightnig bolt. 80th FS color.


LtngRydr
Title: Re: Where did you get your call sign?
Post by: BiPoLaR on February 04, 2015, 12:57:55 AM
My parents met in 1943 on the P-38 assemblyline at Lockheed, in Burbank.
I only fly the three variants of the Lightning.
My last name is Ryder.
I took it a step further with my noseart. My 38 is called Devil Doll.  :devil   Its Bettie Page as a devil, riding a green lightnig bolt. 80th FS color.


LtngRydr
That was way too thought out...Now my head hurts
Title: Re: Where did you get your call sign?
Post by: MajWoody on February 04, 2015, 12:59:03 AM

that plane flying backwards?
Nope, that's it's tail. 
Title: Re: Where did you get your call sign?
Post by: guncrasher on February 04, 2015, 01:31:23 AM
I wonder where the hell DrBone got his from. :O


I just chose mine cause it sounds cool lol

let's just say he was a teenager when he got it.


semp
Title: Re: Where did you get your call sign?
Post by: Tumor on February 04, 2015, 04:03:30 AM
My finger

Tumor
Title: Re: Where did you get your call sign?
Post by: RODBUSTR on February 04, 2015, 05:54:51 AM
    It's a job description....Iron work "rebar" 60 feet long 1 inch diameter setting on highways and interstates.   I personaly can move up to 100,000 lbs. of It  per day.... A call signs should be two short words with hard consonants.   a player may miss the first part and not the second with all the chatter.....It's RODBUSTER......not ROD....We have RODMANS, RODSTERS, BUSTERS.... Also a bunch of numbers is about useless.....You need something that a player can spit out fast....and not try to read off Your ICON....Rodbuster......OUT.
Title: Re: Where did you get your call sign?
Post by: WWhiskey on February 04, 2015, 07:49:44 AM
    It's a job description....Iron work "rebar" 60 feet long 1 inch diameter setting on highways and interstates.   I personaly can move up to 100,000 lbs. of It  per day.... A call signs should be two short words with hard consonants.   a player may miss the first part and not the second with all the chatter.....It's RODBUSTER......not ROD....We have RODMANS, RODSTERS, BUSTERS.... Also a bunch of numbers is about useless.....You need something that a player can spit out fast....and not try to read off Your ICON....Rodbuster......OUT.
check six, "numbers" is what I say,,,    All players with numbers handles,, are named "numbers".
Title: Re: Where did you get your call sign?
Post by: Muzzy on February 04, 2015, 09:16:03 AM
I wish I could say I got the call sign from Muzzy broadheads, but the truth is I was trying to come up with one (all my usual nicks having been taken), and I noticed one of my wife's rubber stamps (the kind you use to make greeting cards and scrapbook pages) had a mouse character named Muzzy on it. Muzzy rhymes with Fuzzy, which is what my co-workers used to call me when I sported a brush cut back in the day, so I went with it.

(http://i78.photobucket.com/albums/j89/ChpGLCorps/muzzy_zpsmtuxcvmn.jpg)

Here he is.
Title: Re: Where did you get your call sign?
Post by: hgtonyvi on February 04, 2015, 09:36:34 AM
I got my call sign Rud3boi from this Island chick I use to date back in High School. She was from Argentina. She called me Rudeboy(in Game Rud3boi) because I was wild and had a very rude Ego in high school. I'm still a bit rude sometimes in real life. If you ever see me in person, your thoughts might be "don't even go F~ck with that guy" since my face is always serious and i'm 6 feet 1 inch and weigh about 190 pounds. Its not that I am pissed or anything its just the way my face is lol. I can be very easy to talk to. PS:i never heard to phrase "sharing is caring". :devil :devil :devil
Title: Re: Where did you get your call sign?
Post by: darkzking on February 04, 2015, 11:08:34 AM
from one of my favorite animes :airplane:
Title: Re: Where did you get your call sign?
Post by: Someguy63 on February 04, 2015, 11:27:04 AM
from one of my favorite animes :airplane:

Who would've thought..... :rofl
Title: Re: Where did you get your call sign?
Post by: Driver on February 04, 2015, 11:52:36 AM
Picked mine cause I like to drive my toy, 96 Corvette Grand Sport #158, on the weekends and to shows....
<S> Driver
Title: Re: Where did you get your call sign?
Post by: darkzking on February 04, 2015, 12:09:03 PM
Who would've thought..... :rofl

https://www.youtube.com/watch?v=MijXc0ECpnM
Title: Re: Where did you get your call sign?
Post by: 1ijac on February 04, 2015, 12:13:09 PM
Handle:  1ijac = one eye jack     Nicknames:  1i (one-eye), Jac                        :lol  Misinterpreted Nicknames:   LiL Jac,  Lilac,  Lijac  

I took this handle back around 20+ years ago in Air Warrior.   A relative flew corsairs in the WWII pacific theater.   His squadron art was a one-eyed pirate with a blade in his teeth.   They used to call sailors on old English ships Jacks.   I just put the name together.  

one-eye    
Title: Re: Where did you get your call sign?
Post by: mikev on February 04, 2015, 02:11:15 PM
 Well my call sign was an easy one. I downloaded the game and played offline for about 2 or 3 weeks to see if i could shoot down all the planes flying in the circle. back then i had just a mouse and had no idea what a stick was or how to use it. after 3 weeks i of trying i knew  when i started playing against you guys, I knew it had to be MAGIC if i shot down any of you guys. that was back in May 2014. now its February 2015.  the first time i flew i of course run into 1 of the better pilots Doc4  who quickly made sure i lived up to my name. I have had my share of frustration in this game but I am not a quitter as you all will find out someday, when you will be the MAGIC kill.
Title: Re: Where did you get your call sign?
Post by: darkzking on February 04, 2015, 02:15:35 PM
Well my call sign was an easy one. I downloaded the game and played offline for about 2 or 3 weeks to see if i could shoot down all the planes flying in the circle. back then i had just a mouse and had no idea what a stick was or how to use it. after 3 weeks i of trying i knew  when i started playing against you guys, I knew it had to be MAGIC if i shot down any of you guys. that was back in May 2014. now its February 2015.  the first time i flew i of course run into 1 of the better pilots Doc4  who quickly made sure i lived up to my name. I have had my share of frustration in this game but I am not a quitter as you all will find out someday, when you will be the MAGIC kill.

Please FOR THE LOVE OF ACES HIGH MAKE ME ONE OF YOUR MAGIC KILLS  :salute :x :cheers: :airplane:
Title: Re: Where did you get your call sign?
Post by: mactak on February 04, 2015, 04:54:43 PM
Had it as a nickname since the 70's. Played basketball and my teammates called me McAdoo after Bob McAdoo of the NBA.
Title: Re: Where did you get your call sign?
Post by: USRanger on February 04, 2015, 09:26:11 PM

that plane flying backwards?

Yes it is.  We are that hooah.
Title: Re: Where did you get your call sign?
Post by: stealth on February 05, 2015, 03:26:44 AM
First I was 88333, then I was Killer88, then I was SkyKing because I needed to fake being some 17 year old kid from Texas because some people in my squad didn't like me but the CO said I just had to re-prove myself, but until then I had to play spy. Then I went to STEALTH, simply because well uhh because she never noticed me, if you catch my drift. So yeah... that and I kept picking off players who were AFK on climb out.
Title: Re: Where did you get your call sign?
Post by: Packrat on February 05, 2015, 09:49:38 AM
Wife says I'm a Packrat and it stuck go figure.
Title: Re: Where did you get your call sign?
Post by: glzsqd on February 05, 2015, 10:21:15 AM
My call sign should be "Jizznastics".  Sadly it doesn't fit.
Title: Re: Where did you get your call sign?
Post by: tmetal on February 05, 2015, 10:50:20 AM
(http://i934.photobucket.com/albums/ad187/Dagamster/TwistedMetalUSCUS-94304-front.jpg) (http://media.photobucket.com/user/Dagamster/media/TwistedMetalUSCUS-94304-front.jpg.html)
Title: Re: Where did you get your call sign?
Post by: R 105 on February 05, 2015, 11:01:30 AM
I took over the game from my daughter's boy friend when he enlisted in the Army. He had it on our home computer because he was always at our house. So I ended up R-105 and I don't even know what it means but it has something to do with German metal music I was told.  :headscratch:
Title: Re: Where did you get your call sign?
Post by: Slate on February 05, 2015, 11:15:01 AM
I took over the game from my daughter's boy friend when he enlisted in the Army. He had it on our home computer because he was always at our house. So I ended up R-105 and I don't even know what it means but it has something to do with German metal music I was told.  :headscratch:

 I have a better story for ya.... :D


(http://i665.photobucket.com/albums/vv15/d0nwaters/R-105_zps08429265.jpg) (http://s665.photobucket.com/user/d0nwaters/media/R-105_zps08429265.jpg.html)


R-105M
 R-105, R-105D, R-105M
 The most common of all the Russian radios to be found all over the world, is the R-105 family of backpack radios. The radio is rather primitive by anybody's standards, it is not easy to use, nor does it have any saving graces save one, "If you fire one up, it usually works". First introduced in the early 1950's, it was revamped in the 1960's to use more modern materials ( D models ), and again in the 1970's ( M models ). It has been referred to by many as a slightly updated copy of captured WW-II German sets and many of it's characteristics, and accessories will show this lineage.
Title: Re: Where did you get your call sign?
Post by: Latrobe on February 05, 2015, 02:58:06 PM
My name has a rather dumb and boring story to it. I was trying to think of a good name to use. I looked around the room for inspiration. I saw a Rolling Rock bottle and the word "Latrobe". I said "That'll do".  :)
Title: Re: Where did you get your call sign?
Post by: darkzking on February 05, 2015, 03:00:23 PM
My name has a rather dumb and boring story to it. I was trying to think of a good name to use. I looked around the room for inspiration. I saw a Rolling Rock bottle and the word "Latrobe". I said "That'll do".  :)

Dang Latrobe that story was deep :o
Title: Re: Where did you get your call sign?
Post by: Dragon Tamer on February 05, 2015, 03:35:34 PM
My name has a rather dumb and boring story to it. I was trying to think of a good name to use. I looked around the room for inspiration. I saw a Rolling Rock bottle and the word "Latrobe". I said "That'll do".  :)

And then there's your new name, which I still can't believe you were so willing to adopt. You not only did that but you even got into character!  :rofl

I got my forum name from the nickname I was given in high school. It didn't fit the AH 8 character limit so I came up with something better. Player1... sad thing is it took me 15 minutes to come up with it...  :uhoh
Title: Re: Where did you get your call sign?
Post by: Chugamug on February 08, 2015, 01:24:39 PM
From a beer bottle. :cheers:
Title: Re: Where did you get your call sign?
Post by: guncrasher on February 08, 2015, 01:38:41 PM
I got the name guncrasher because back in the aw days I was a pretty good gunner by I would crash every plane I took off in.

my brother first joined aw before me and just like me he would always crash everything.  he was also a pretty good gunner.

he picked the name semp in aw as in semper fi.  he was in the marines, like me.  when I came back to aces high the name semp was taken so I came up with the guncrasher in the bb and in the game.  when semp became available I took it that was 5 or 6 years ago.


semp
Title: Re: Where did you get your call sign?
Post by: MrRiplEy[H] on February 08, 2015, 02:01:48 PM
I picked my name from the movie 'the talented Mr Ripley' mostly because I wanted to consider myself talented, pretty arrogantly.

My future squad mates quickly translated the callsign to the finnish word 'ripuli' which means diarrhea.
Title: Re: Where did you get your call sign?
Post by: Bizman on February 08, 2015, 02:14:10 PM
Every now and then someone asks whether my nick is trying to tell I were somewhat weird. Their diagnosis may be correct but that's not the story behind my nick.

Way back before AH was launched in any form I needed a nickname for an Internet auction. I had long been a sales representative, a prosperous businessman as the bosses tried to convince us to be. IIRC there was some character limit as well as in many other places after that, including AH, so I just shortened it to what it has since been. Sorry, nothing bizarre here, move along.
Title: Re: Where did you get your call sign?
Post by: Windycty on February 08, 2015, 07:05:14 PM
I was born and raised in the Chicago-land area, not much more to it than that!
Title: Re: Where did you get your call sign?
Post by: shppr01 on February 08, 2015, 09:35:51 PM
After 12 years of being a chef, I decided to change a tiny bit. I moved from Idaho to MD and became a shipping manager for a printing co. Hence, Shipper.
Title: Re: Where did you get your call sign?
Post by: Scotch on February 08, 2015, 10:06:45 PM
I got pissed off at everyone mispronouncing my old name and changed it to the first thing I saw on my desk. A bottle of scotch. It's also my heritage.
Title: Re: Where did you get your call sign?
Post by: Molsman on February 08, 2015, 10:14:04 PM
From a beer bottle. :cheers:

Same Here Lol :cheers: :cheers: :cheers:
Title: Re: Where did you get your call sign?
Post by: Gard06 on February 08, 2015, 11:39:27 PM
On 02/24/1991 our unit   B co. 1/159 Aviation 18th Airborne Corp. was in the southern part of Iraq.   On that day we lost over 5 guys in a Helicopter crash.   Our commander Major. Rosie was flying lead aircraft.  Call sign Gard06.   We reported small arms fire off the left hand side and in less then a 1/100 of a second later the CH-47 she was in command of was no longer there, I however was in the other CH-47 in formation watching this unfold with disbelief...

Rossi was born in Oradell, New Jersey on January 3, 1959, the third of four children born to Paul and Gertrude Rossi. Her father was a book bindery treasurer, and her mother was a secretary for a Wall Street firm.[2] In 1976, she graduated from River Dell Regional High School and began attending Dickinson College, where she also joined the Reserve Officers' Training Corps. Rossi graduated in 1980, with a Bachelor of Science in Psychology.[3]


Career:

“    What I'm doing is no greater or less than the man who is flying next to me or in back of me...   ”

Rossi served as a CH-47 Chinook pilot with the 18th Aviation Brigade, commanding B Company, 2d Battalion, 159th Aviation Regiment, stationed at Hunter Army Airfield, Savannah, Georgia. Her company deployed to Saudi Arabia in support of Operation Desert Shield in 1990. Rossi was interviewed by CNN prior to the ground assault by Coalition forces. She said, "Sometimes, you have to disassociate how you feel personally about the prospect of going into war and, you know, possibly see the death that's going to be out there. But personally, as an aviator and a soldier, this is the moment that everybody trains for -- that I've trained for -- so I feel ready to meet a challenge."[5]

Rossi led a flight of her company's CH-47 Chinook helicopters 50 miles (80 km) into Iraq on February 24, 1991, ferrying fuel and ammunition during the very first hours of the ground assault by the Coalition Forces. Her company would be involved in supply missions throughout the war. Rossi was killed when her helicopter crashed into an unlit microwave tower in Northern Saudi Arabia on March 1, 1991, the day after the ceasefire agreement.[6] She was buried on March 11, 1991 with full military honors at Arlington National Cemetery, Section 8, Grave 9872 (38.87170°N 77.06594°W)....



In Honor of those 6 friends and  great commander.   (I AM   GARD06)
Title: Re: Where did you get your call sign?
Post by: Gard06 on February 08, 2015, 11:49:26 PM
Military awards and decorations
Bronze Star ribbon.svg    Bronze Star Medal[6]
Purple Heart BAR.svg    Purple Heart[6]
Meritorious Service ribbon.svg    Meritorious Service Medal[9]
Air Medal ribbon.svg    Air Medal[6]
Army Commendation Medal ribbon.svg    Army Commendation Medal[9]
Bronze oak leaf cluster
Width-44 ribbon with two width-9 ultramarine blue stripes surrounded by two pairs of two width-4 green stripes; all these stripes are separated by width-2 white borders
   Army Achievement Medal 2x[6][9]
National Defense Service Medal ribbon.svg    National Defense Service Medal[9]
Bronze star
Bronze star
Width-44 ribbon with the following stripes, arranged symmetrically from the edges to the center: width-2 black, width-4 chamois, width-2 Old Glory blue, width-2 white, width-2 Old Glory red, width-6 chamouis, width-3 myrtle green up to a central width-2 black stripe
   Southwest Asia Service Medal with two bronze service stars for two designated campaigns[9]
Korea Defense Service ribbon.svg    Korea Defense Service Medal[9]
Army Service Ribbon.svg    Army Service Ribbon[9]
Army Overseas Service Ribbon.svg    Army Overseas Service Ribbon[9]
Us sa-kwlib rib.png    Kuwait Liberation Medal (Saudi Arabia)[9]
Us kw-kwlib rib.png    Kuwait Liberation Medal (Kuwait)
Title: Re: Where did you get your call sign?
Post by: Gard06 on February 08, 2015, 11:50:35 PM
Dear Friend and my Commander
Title: Re: Where did you get your call sign?
Post by: Mar on February 09, 2015, 01:43:30 AM

 :salute
Title: Re: Where did you get your call sign?
Post by: SPKmes on February 09, 2015, 03:08:29 AM
The kitchen

  3rd draw down
Title: Re: Where did you get your call sign?
Post by: MajWoody on February 09, 2015, 05:37:25 AM
I got mine from an episode of Beavis and Butthead  :o
Title: Re: Where did you get your call sign?
Post by: branch37 on February 09, 2015, 05:44:26 AM
My first name is Branch.
Title: Re: Where did you get your call sign?
Post by: M1A1 on February 09, 2015, 11:07:36 AM
Got mine from my favorite piece of machinery...Nothing like putting steel on target...It's a shame that I am nowhere near as good in a cartoon plane as I was in the beast...Oh well at least I can get as many cartoon lives as 1
$15 can buy a month!! :)
Title: Re: Where did you get your call sign?
Post by: HGBuck on February 10, 2015, 07:45:42 PM
My first dog Buck...see avatar, that was the last picture taken of him, he loved to fly!
Title: Re: Where did you get your call sign?
Post by: Obie303 on February 11, 2015, 07:10:23 AM
Obie was my father's nickname in the service.  The 303 is from the RAF 303 "Kościuszko Squadron".
Title: Re: Where did you get your call sign?
Post by: TequilaChaser on February 11, 2015, 07:28:41 AM
actually, I have avoid daddog's op for years..........

I received TC ( TequilaChaser ) somewhere around 1986/87, several of us was drunk ( in the Navy ) while at sea on the Nimitz, we pulled into port near Canes, France....and one evening I through a short punch (my left elbow) at one of my squadmates while fighting over the worm in the bottle..... I will not post exactly what I did to his teeth/mouth , but my chasing after what Tequila was left , earned me my name.......


I more than likely spelled several words/names wrong........\\one thing


I have and will never do is post or talk about my military jacket or what I have actually done in detail........a drunk typed something here.......... , but that is for my kids and family, and is not for this board.....


cheers

TC

Title: Re: Where did you get your call sign?
Post by: MrRiplEy[H] on February 11, 2015, 08:28:12 AM
actually, I have avoid daddog's op for years..........

I received TC ( TequilaChaser ) somewhere around 1986/87, several of us was drunk ( in the Navy ) while at sea on the Nimitz, we pulled into port near Canes, France....and one evening I through a short punch (my left elbow) at one of my squadmates while fighting over the worm in the bottle..... I will not post exactly what I did to his teeth/mouth , but my chasing after what Tequila was left , earned me my name.......


I more than likely spelled several words/names wrong........\\one thing


I have and will never do is post or talk about my military jacket or what I have actually done in detail........ I know my ribbons, medals and certificates, etc.......... whatI accomplished, but hat is for my kids and family, and is not for this board.....


cheers

TC



Ok we will disregard your bragging about your ribbons and certificates. Let's just pretend none of that stuff was written.  :neener:
Title: Re: Where did you get your call sign?
Post by: TequilaChaser on February 11, 2015, 08:45:26 AM
Ok we will disregard your bragging about your ribbons and certificates. Let's just pretend none of that stuff was written.  :neener:

pardon me, even though I never said what I actually received or went in to detail....as I said, that is simply for my Family


TC ( I have no need to brag about anything I have ever done! )


or you can go with that song by Ratt.... Loose Lips.... what ya think???

edit: ( this is called where TC get's a bit angry) 2nd edit: what I posted was a bit harsh, and I mean no ill will toward anyone........hope that is a bit better than my previous posting
Title: Re: Where did you get your call sign?
Post by: Flifast on February 12, 2015, 08:27:39 PM
Flifast.

Pushed the envelope a bit back in the day.



http://en.m.wikipedia.org/wiki/Dassault_Falcon_10


Here is the early military version that was converted to the fast corp version.


http://youtu.be/t3dnIy6alk4
Title: Re: Where did you get your call sign?
Post by: Trainee on February 12, 2015, 09:23:14 PM
Because I felt like a Trainee in basic when I started this game in '04.

Almost changed it a few years back but everyone knows me by it so I just kept it as is. 



Title: Re: Where did you get your call sign?
Post by: SFRT - Frenchy on February 15, 2015, 01:19:58 AM
Frenchy ... geez I don't know  :)
Funny thing is AH is the only place where Im cool when people call me Frenchy. In real life I get in the person's face starting a fight. Almost got me fired once :headscratch:
Title: Re: Where did you get your call sign?
Post by: TequilaChaser on February 15, 2015, 07:47:30 PM
Frenchy ... geez I don't know  :)
Funny thing is AH is the only place where Im cool when people call me Frenchy. In real life I get in the person's face starting a fight. Almost got me fired once :headscratch:

you've been Frenchy for many years to me, heck I might want to fight you if you look at me the wrong way, and I don't even know who you are! hehe...

but no one can not tell me it has not been fun!

TC


Frenchy knows I am only BS'ing here........ I seriously do not want to get this thread lock, even though it was necro bumped umpteen times over the years......
Title: Re: Where did you get your call sign?
Post by: SFRT - Frenchy on February 15, 2015, 08:17:23 PM
(http://www.troll.me/images/thumbs-up-jesus-says/i-got-you-back-bro-manfest-dispensation.jpg)
Title: Re: Where did you get your call sign?
Post by: Ray77 on February 19, 2015, 08:55:41 AM
From the second best NHL Defenseman all time and the second best Bruin Defenseman of all time.
Title: Re: Where did you get your call sign?
Post by: Pluto on February 19, 2015, 01:40:59 PM
From the second best NHL Defenseman all time and the second best Bruin Defenseman of all time.

 :aok