Author Topic: Covid19 Paranoia  (Read 17523 times)

Offline Meatwad

  • Plutonium Member
  • *******
  • Posts: 12995
Re: Covid19 Paranoia
« Reply #120 on: April 06, 2020, 08:29:59 PM »
What about the nutjobs burning the 5G cell towers because they believe that is spreading the coronavirus
See Rule 19- Do not place sausage on pizza.
I am No-Sausage-On-Pizza-Wad.
Das Funkillah - I kill hangers, therefore I am a funkiller. Coming to a vulchfest near you.
You cant tie a loop around 400000 lbs of locomotive using a 2 foot rope - Drediock on fat women

Offline Maverick

  • Plutonium Member
  • *******
  • Posts: 13958
Re: Covid19 Paranoia
« Reply #121 on: April 07, 2020, 09:47:11 AM »
Well one thing is sure about the paranoia and that is the hording that is STILL going on. We buy groceries once a week. Never a lot of stuff since it's just the two of us, and we're 66 and 71. We have been using the option to get wally world stuff (staples, never fresh fruit or vegies) delivered to the car instead of going in. Now they seem to have cut back to being open 2 days a week and they have a set number of slots per day to get your stuff. The last 2 weeks the wife hasn't been able to get a slot. It seems you have to know someone in the store and in this small town there is only one store.

Nancy found out the local state chain of grocery stores (H E B) would deliver to the house. She made an order for groceries online. They delivered one item, a small pack of TP. No groceries. We have been out of "fresh" (frozen) meat for 3 weeks now, cereal for a week and a half. If I could I'd get a hunting license (office closed) and shoot one of the axis deer running around the property. They are an invasive species so no season, limit or tag needed, just a license. If it gets much worse I'll shoot one without the license and hope none of the neighbors snitch me off.

Getting real tired of my "fellow man's" actions.
DEFINITION OF A VETERAN
A Veteran - whether active duty, retired, national guard or reserve - is someone who, at one point in their life, wrote a check made payable to "The United States of America", for an amount of "up to and including my life."
Author Unknown

Offline Shuffler

  • Radioactive Member
  • *******
  • Posts: 27587
Re: Covid19 Paranoia
« Reply #122 on: April 07, 2020, 10:20:59 AM »
Yes we normally pick our groceries up but now we have to order 5 days ahead. Several things you have to go inside now. We just go inside to shop now until this is over. Stores here are getting supplies now. Plenty of paper and other items that were being hoarded.

We are in SE Texas so we shop Kroger and some at HEB.
« Last Edit: April 07, 2020, 10:22:35 AM by Shuffler »
80th FS "Headhunters"

S.A.P.P.- Secret Association Of P-38 Pilots (Lightning In A Bottle)

Offline bustr

  • Plutonium Member
  • *******
  • Posts: 12436
Re: Covid19 Paranoia
« Reply #123 on: April 13, 2020, 03:45:36 PM »
Here is the link to the research paper from Wuhan where they found a cave in China where the bats had 11 strains of SARS. Those were brought back to the Lab in Wuhan where they cloned them and created less virulent chimeric versions visa recombining genes to test how the virus infects humans cells through ACE2 receptors. The study took place 2011-2015 with the paper being published in 2017. The NIH under Obama contributed $3.7m for the research. Dr. Fauci was with the NIH at that time and aware of SARS. SARS back then had a 30% mortality rate and our original NIH mortality numbers was 2.2m dead. So makes me wonder if Fauci needed the USA shut down for 3 weeks to see if this was SARS-CoV or COVID-19. Essentially a death sentence for 30% infected or a bad flu season. Also SARS-CoV has a high ability to mutate so 3 weeks may also have been to see if COVID-19 evolved into it's parent virus SARS.

https://journals.plos.org/plospathogens/article?id=10.1371/journal.ppat.1006698

In their paper the Chinese posted how they created the chimeric viruses for their testing. COVID-19 may be one of those constructed versions to test the ACE2 receptors since that is it's primary vector to infect human cells. Hydroxychloroquine\Chloroquine impair the ability of COVID-19 to use the ACE2 vector and back in 2005 they were tested against SARS and found to protect cells from being invaded by the SARS-CoV virus in laboratory tests.
-------------------------------------------------------
Construction of recombinant viruses

Recombinant viruses with the S gene of the novel bat SARSr-CoVs and the backbone of the infectious clone of SARSr-CoV WIV1 were constructed using the reverse genetic system described previously [23] (S9 Fig). The fragments E and F were re-amplified with primer pairs (FE, 5’-AGGGCCCACCTGGCACTGGTAAGAGTCATTTTGC-3’, R-EsBsaI, 5’-ACTGGTCTCTTCGTTTAGTTATTAACTAAAATATCACTAGACACC-3’) and (F-FsBsaI, 5’-TGAGGTCTCCGAACTTATGGATTTGTTTATGAG-3’, RF, 5’-AGGTAGGCCTCTAGGGCAGCTAAC-3’), respectively. The products were named as fragment Es and Fs, which leave the spike gene coding region as an independent fragment. BsaI sites (5’-GGTCTCN|NNNN-3’) were introduced into the 3’ terminal of the Es fragment and the 5’ terminal of the Fs fragment, respectively. The spike sequence of Rs4231 was amplified with the primer pair (F-Rs4231-BsmBI, 5’-AGTCGTCTCAACGAACATGTTTATTTTCTTATTCTTTCTCACTCTCAC-3’ and R-Rs4231-BsmBI, 5’-TCACGTCTCAGTTCGTTTATGTGTAATGTAATTTGACACCCTTG-3’). The S gene sequence of Rs7327 was amplified with primer pair (F-Rs7327-BsaI, 5’-AGTGGTCTCAACGAACATGAAATTGTTAGTTTTAGTTTTTGCTAC-3’ and R-Rs7327-BsaI, 5’- TCAGGTCTCAGTTCGTTTATGTGTAATGT AATTTAACACCCTTG-3’). The fragment Es and Fs were both digested with BglI (NEB) and BsaI (NEB). The Rs4231 S gene was digested with BsmBI. The Rs7327 S gene was digested with BsaI. The other fragments and bacterial artificial chromosome (BAC) were prepared as described previously. Then the two prepared spike DNA fragments were separately inserted into BAC with Es, Fs and other fragments. The correct infectious BAC clones were screened. The chimeric viruses were rescued as described previously [23].
bustr - POTW 1st Wing


This is like the old joke that voters are harsher to their beer brewer if he has an outage, than their politicians after raising their taxes. Death and taxes are certain but, fun and sex is only now.

Offline icepac

  • Platinum Member
  • ******
  • Posts: 7490
Re: Covid19 Paranoia
« Reply #124 on: April 13, 2020, 06:50:25 PM »
Unless the data is wrong, USA has 100,000 new cases today.

Offline CptTrips

  • Plutonium Member
  • *******
  • Posts: 9188
Re: Covid19 Paranoia
« Reply #125 on: April 13, 2020, 06:55:29 PM »
Unless the data is wrong, USA has 100,000 new cases today.

Are you sure that isn't world or something?

It looks to me like new daily is 26,077.

 :headscratch:
Toxic, psychotic, self-aggrandizing drama queens simply aren't worth me spending my time on.

Offline CptTrips

  • Plutonium Member
  • *******
  • Posts: 9188
Re: Covid19 Paranoia
« Reply #126 on: April 13, 2020, 07:04:20 PM »
Know, it's strange times we live in.

I was looking at the number today and imagining myself 6 months ago that looking at a 1500 death day and thinking, "Oh that's not bad at all."

I remember a month ago telling my parents that we might end up seeing 1000 deaths a day and being slight embarrassed at how crazy that sounded saying it out load.
 
Strange days.
Toxic, psychotic, self-aggrandizing drama queens simply aren't worth me spending my time on.

Offline icepac

  • Platinum Member
  • ******
  • Posts: 7490
Re: Covid19 Paranoia
« Reply #127 on: April 13, 2020, 07:55:29 PM »

Yeah....they corrected it.

Offline MiloMorai

  • Platinum Member
  • ******
  • Posts: 6865
Re: Covid19 Paranoia
« Reply #128 on: April 13, 2020, 08:04:20 PM »
Are you sure that isn't world or something?

It looks to me like new daily is 26,077.

 :headscratch:
United States cases
Updated 13 Apr at 9:02 PM local
Confirmed
586,057
+27,289
Deaths
23,604
+1,583
Recovered
43,637
+10,733

Offline Eagler

  • Plutonium Member
  • *******
  • Posts: 19485
Re: Covid19 Paranoia
« Reply #129 on: April 14, 2020, 07:06:44 AM »
Bustr

Does that make it sound like this virus was naturally created and released?

Doesn't to me

Eagler
"Masters of the Air" Scenario - JG27


Intel Core i7-13700KF | GIGABYTE Z790 AORUS Elite AX | 64GB G.Skill DDR5 | 16GB GIGABYTE RTX 4070 Ti Super | 850 watt ps | pimax Crystal Light | Warthog stick | TM1600 throttle | VKB Mk.V Rudder

Offline Arlo

  • Radioactive Member
  • *******
  • Posts: 24760
Re: Covid19 Paranoia
« Reply #130 on: April 14, 2020, 07:49:41 AM »
Bustr

Does that make it sound like this virus was naturally created and released?

Doesn't to me

Eagler

What is naturally created and released?

Offline Eagler

  • Plutonium Member
  • *******
  • Posts: 19485
Re: Covid19 Paranoia
« Reply #131 on: April 14, 2020, 09:37:48 AM »
What is naturally created and released?

A natural occurrence without any human manipulation or intervention

Eagler
"Masters of the Air" Scenario - JG27


Intel Core i7-13700KF | GIGABYTE Z790 AORUS Elite AX | 64GB G.Skill DDR5 | 16GB GIGABYTE RTX 4070 Ti Super | 850 watt ps | pimax Crystal Light | Warthog stick | TM1600 throttle | VKB Mk.V Rudder

Offline Busher

  • Gold Member
  • *****
  • Posts: 2434
Re: Covid19 Paranoia
« Reply #132 on: April 14, 2020, 09:53:03 AM »
A natural occurrence without any human manipulation or intervention

Eagler

Posted in the other discussion.

https://www.sciencenews.org/article/coronavirus-covid-19-not-human-made-lab-genetic-analysis-nature
Being male, an accident of birth. Being a man, a matter of age. Being a gentleman, a matter of choice.

Offline CptTrips

  • Plutonium Member
  • *******
  • Posts: 9188
Re: Covid19 Paranoia
« Reply #133 on: April 14, 2020, 12:17:31 PM »

While I think the preponderance of evidence confirms the virus is not man-made, this is pretty interesting:

https://www.nationalreview.com/news/u-s-diplomats-warned-about-safety-risks-in-wuhan-labs-studying-bats-two-years-before-coronavirus-outbreak/


There were Bio-labs in Wuhan studying CoronaVirus in bats.  That is an amazing coincidence.   :noid
Toxic, psychotic, self-aggrandizing drama queens simply aren't worth me spending my time on.

Offline Eagler

  • Plutonium Member
  • *******
  • Posts: 19485
Re: Covid19 Paranoia
« Reply #134 on: April 14, 2020, 12:35:06 PM »
While I think the preponderance of evidence confirms the virus is not man-made, this is pretty interesting:

https://www.nationalreview.com/news/u-s-diplomats-warned-about-safety-risks-in-wuhan-labs-studying-bats-two-years-before-coronavirus-outbreak/


There were Bio-labs in Wuhan studying CoronaVirus in bats.  That is an amazing coincidence.   :noid

Correction- there ARE bio weapon labs in Wuhan that ARE studying Coronavirus in bats

My guess is they are studying it in humans too

Eagler
"Masters of the Air" Scenario - JG27


Intel Core i7-13700KF | GIGABYTE Z790 AORUS Elite AX | 64GB G.Skill DDR5 | 16GB GIGABYTE RTX 4070 Ti Super | 850 watt ps | pimax Crystal Light | Warthog stick | TM1600 throttle | VKB Mk.V Rudder