Here is the link to the research paper from Wuhan where they found a cave in China where the bats had 11 strains of SARS. Those were brought back to the Lab in Wuhan where they cloned them and created less virulent chimeric versions visa recombining genes to test how the virus infects humans cells through ACE2 receptors. The study took place 2011-2015 with the paper being published in 2017. The NIH under Obama contributed $3.7m for the research. Dr. Fauci was with the NIH at that time and aware of SARS. SARS back then had a 30% mortality rate and our original NIH mortality numbers was 2.2m dead. So makes me wonder if Fauci needed the USA shut down for 3 weeks to see if this was SARS-CoV or COVID-19. Essentially a death sentence for 30% infected or a bad flu season. Also SARS-CoV has a high ability to mutate so 3 weeks may also have been to see if COVID-19 evolved into it's parent virus SARS.
https://journals.plos.org/plospathogens/article?id=10.1371/journal.ppat.1006698In their paper the Chinese posted how they created the chimeric viruses for their testing. COVID-19 may be one of those constructed versions to test the ACE2 receptors since that is it's primary vector to infect human cells. Hydroxychloroquine\Chloroquine impair the ability of COVID-19 to use the ACE2 vector and back in 2005 they were tested against SARS and found to protect cells from being invaded by the SARS-CoV virus in laboratory tests.
-------------------------------------------------------
Construction of recombinant viruses
Recombinant viruses with the S gene of the novel bat SARSr-CoVs and the backbone of the infectious clone of SARSr-CoV WIV1 were constructed using the reverse genetic system described previously [23] (S9 Fig). The fragments E and F were re-amplified with primer pairs (FE, 5’-AGGGCCCACCTGGCACTGGTAAGAGTCATTTTGC-3’, R-EsBsaI, 5’-ACTGGTCTCTTCGTTTAGTTATTAACTAAAATATCACTAGACACC-3’) and (F-FsBsaI, 5’-TGAGGTCTCCGAACTTATGGATTTGTTTATGAG-3’, RF, 5’-AGGTAGGCCTCTAGGGCAGCTAAC-3’), respectively. The products were named as fragment Es and Fs, which leave the spike gene coding region as an independent fragment. BsaI sites (5’-GGTCTCN|NNNN-3’) were introduced into the 3’ terminal of the Es fragment and the 5’ terminal of the Fs fragment, respectively. The spike sequence of Rs4231 was amplified with the primer pair (F-Rs4231-BsmBI, 5’-AGTCGTCTCAACGAACATGTTTATTTTCTTATTCTTTCTCACTCTCAC-3’ and R-Rs4231-BsmBI, 5’-TCACGTCTCAGTTCGTTTATGTGTAATGTAATTTGACACCCTTG-3’). The S gene sequence of Rs7327 was amplified with primer pair (F-Rs7327-BsaI, 5’-AGTGGTCTCAACGAACATGAAATTGTTAGTTTTAGTTTTTGCTAC-3’ and R-Rs7327-BsaI, 5’- TCAGGTCTCAGTTCGTTTATGTGTAATGT
AATTTAACACCCTTG-3’). The fragment Es and Fs were both digested with BglI (NEB) and BsaI (NEB). The Rs4231 S gene was digested with BsmBI. The Rs7327 S gene was digested with BsaI. The other fragments and bacterial artificial chromosome (BAC) were prepared as described previously. Then the two prepared spike DNA fragments were separately inserted into BAC with Es, Fs and other fragments. The correct infectious BAC clones were screened. The chimeric viruses were rescued as described previously [23].
