Covid 19 Prevention discussion ONLY

[CptTrips]

If you have a family member who sews it isn't hard to produce your own masks.  About mid-March it became obvious this was going to last a while and masks would be needed.    I ordered material and sent to my mom who sews and she downloaded some patterns off the internet and made some prototypes. 

She said the pleated ones were actually easier to make and easier to get a good fit on the face than the cup shaped.  All of these have an extra pocket for a sheet of paper towel or tissue as a disposable filter layer.  They say a sheet of that blue paper towel material like mechanics use has a filter almost as good as N95.  She also got fancy and sewed in a piece of florist wire across the nose bridge of each.  I wonder where I inherited my obsessive-compulsion from. 

She is going to send me those prototypes to try out and then we should have enough fabrics to get masks to our family members.  I'm suspecting the pleated tie strap version is going to be best.  I hear hospitals are preferring those for donated homemade masks as they are more durable and can fit a wider range of head sizes tightly.  More adjustable.

Get those sewing machines rolling. Homemade masks are the new Victory Garden.

[Shuffler]

I like the reports that are coming out now in Texas. They break down how many are recovered, how many hospitalized, how many beds available, how many respirators and such.

While it is an issue in Texas, it is a small one still.

[Shuffler]

If you have a family member who sews it isn't hard to produce your own masks.  About mid-March it became obvious this was going to last a while and masks would be needed.    I ordered material and sent to my mom who sews and she downloaded some patterns off the internet and made some prototypes. 

She said the pleated ones were actually easier to make and easier to get a good fit on the face than the cup shaped.  All of these have an extra pocket for a sheet of paper towel or tissue as a disposable filter layer.  They say a sheet of that blue paper towel material like mechanics use has a filter almost as good as N95.  She also got fancy and sewed in a piece of florist wire across the nose bridge of each.  I wonder where I inherited my obsessive-compulsion from. 

She is going to send me those prototypes to try out and then we should have enough fabrics to get masks to our family members.  I'm suspecting the pleated tie strap version is going to be best.  I hear hospitals are preferring those for donated homemade masks as they are more durable and can fit a wider range of head sizes tightly.  More adjustable.

Get those sewing machines rolling. Homemade masks are the new Victory Garden.



(Image removed from quote.)

Some folks around here wearing bandanas.

[DREDIOCK]

Good news and bad news.

https://reason.com/2020/04/09/preliminary-german-study-shows-a-covid-19-infection-fatality-rate-of-about-0-4-percent/

My thoughts on that would be:

a.  If our numbers are similar, it means we are no where close to Herd Immunity.  For this infection I've heard number between 70-85% to achieve effective Herd Immunity.
https://www.jhsph.edu/covid-19/articles/achieving-herd-immunity-with-covid19.html

b.  They didn't mention it is also 2-3x more infectious.   2-3x more infectious and 4x more lethal is still pretty concerning to me.

c.  I can think of at least 3 reasons our CFR number probably won't be as good as Germany's, but I don't want to take the chance of invoking Hitech's rules.

I'd consider Germany and S. Korea outcomes as the best possible outcomes if you do almost everything right.  I suspect our numbers are going to look a lot more like Italy before it's over.

 

I pointed at Germanys abnormal mortality rate here 3 weeks ago

[Maverick]

My county (Kerr) is reporting 2 confirmed cases, no deaths as of last night.

[Arlo]

My county (Kerr) is reporting 2 confirmed cases, no deaths as of last night.

Ah, Kerrville. Best of luck to ya'll.

[CptTrips]

My county (Kerr) is reporting 2 confirmed cases, no deaths as of last night.

Those in rural areas of course have the great advantage of low density.  On the other hand they tend to be an older demographic that is more susceptible. And if they are like my relatives out West Texas, they are probably hard to convince to take this threat seriously.  And sooner or later they have to go into a population center to get supplies.  I fear that it will get out there and spread through their Walmarts and churches and those areas have very sparse medical resources.

Something like 80% of the population of Texas is in it's major cities.  We've also been very slow with testing.  So it's easier to look good on the numbers if you don't test.  Texas is at the VERY bottom of the list for testing per 1mil population.  Dead last.   50th in testing.  15th in reported deaths, and I suspect that is materially under counted.   Don't Test Don't Tell.    Even Oklahoma has done a better job at testing than us. 

Ok-la-ho-ma... (face palm)

I'd like to hope we have some magical immunity, but I don't see why we would. DFW is a major air hub.  Houston a major shipping hub.  I think its probably a given that our numbers are under reported.

 

[bustr]

I kept searching for peer reviewed research papers on the SARS-CoV virus family. Back in the 2000's China was hit with SARS which had a devastating mortality rate. In 2011 out of the Lab in Wuhan they started a 5 year research project to find the source of the SARS-CoV virus. The Obama administration invested $3.7m to the study.

Between 2011 and 2015 in Yunnan they found a bat cave and about 11 versions of the SARS virus. They brought those back to Yuhan and replicated them and also created chimeric versions of them to test how those viruses infected human cells.

I was doing research on how the COVID-19 with some patients destroyed the heart, organs and lungs. It had to do with a protein receptor called Angiotensin-converting enzyme 2 (ACE2). This is the primary common vector into humans cells for COVID-19 and SARS-CoV. Oh..the word chimeric means they created a SARS virus for the experiment. Below is a paragraph from the research paper that may well be how we got COVID-19.

https://journals.plos.org/plospathogens/article?id=10.1371/journal.ppat.1006698

 Our previous studies demonstrated the capacity of both WIV1 and WIV16 to use ACE2 orthologs for cell entry and to efficiently replicate in human cells [17,18]. In this study, we confirmed the use of human ACE2 as receptor of two novel SARSr-CoVs by using chimeric viruses with the WIV1 backbone replaced with the S gene of the newly identified SARSr-CoVs. Rs7327’s S protein varied from that of WIV1 and WIV16 at three aa residues in the receptor-binding motif, including one contact residue (aa 484) with human ACE2. This difference did not seem to affect its entry and replication efficiency in human ACE2-expressing cells.

I have to think Dr. Fauci was aware of this study because he was with the NIH at the time of the research project and the NIH provided the $3.7m funding for the research. One might venture he talked the president into shutting the country down for 3 weeks to see if this virus was SARS-CoV which has up to a 30% mortality rate. Hmmmm, 2.2m dead estimate maybe, way back three weeks ago. Or COVID-19 which is a bad flu season. And to see if it would mutate into something worse because the study I included suggests the SARS family of viruses mutate easily.

[bustr]

Here another clip from the research paper on how they created their own viruses for testing purposes of SARS-CoV.


Construction of recombinant viruses

Recombinant viruses with the S gene of the novel bat SARSr-CoVs and the backbone of the infectious clone of SARSr-CoV WIV1 were constructed using the reverse genetic system described previously [23] (S9 Fig). The fragments E and F were re-amplified with primer pairs (FE, 5’-AGGGCCCACCTGGCACTGGTAAGAGTCATTTTGC-3’, R-EsBsaI, 5’-ACTGGTCTCTTCGTTTAGTTATTAACTAAAATATCACTAGACACC-3’) and (F-FsBsaI, 5’-TGAGGTCTCCGAACTTATGGATTTGTTTATGAG-3’, RF, 5’-AGGTAGGCCTCTAGGGCAGCTAAC-3’), respectively. The products were named as fragment Es and Fs, which leave the spike gene coding region as an independent fragment. BsaI sites (5’-GGTCTCN|NNNN-3’) were introduced into the 3’ terminal of the Es fragment and the 5’ terminal of the Fs fragment, respectively. The spike sequence of Rs4231 was amplified with the primer pair (F-Rs4231-BsmBI, 5’-AGTCGTCTCAACGAACATGTTTATTTTCTTATTCTTTCTCACTCTCAC-3’ and R-Rs4231-BsmBI, 5’-TCACGTCTCAGTTCGTTTATGTGTAATGTAATTTGACACCCTTG-3’). The S gene sequence of Rs7327 was amplified with primer pair (F-Rs7327-BsaI, 5’-AGTGGTCTCAACGAACATGAAATTGTTAGTTTTAGTTTTTGCTAC-3’ and R-Rs7327-BsaI, 5’- TCAGGTCTCAGTTCGTTTATGTGTAATGT AATTTAACACCCTTG-3’). The fragment Es and Fs were both digested with BglI (NEB) and BsaI (NEB). The Rs4231 S gene was digested with BsmBI. The Rs7327 S gene was digested with BsaI. The other fragments and bacterial artificial chromosome (BAC) were prepared as described previously. Then the two prepared spike DNA fragments were separately inserted into BAC with Es, Fs and other fragments. The correct infectious BAC clones were screened. The chimeric viruses were rescued as described previously [23].

[Shuffler]

Texas is 30 plus million people. I feel confident anyone dieing it is known how they died. As for testing, it is moving along. I only know of one person who tried to be tested and he was told to go home and shelter. His wife had a bug for about 24 hours and then she was fine.

[CptTrips]

An airborne version of AIDS?  Great.

Start at 8:55   Interesting but disturbing.  Covid-19 my be acting like AIDS.  Some evidence on why hydroxychloroquine my have effectiveness.  Possible long term damage even if you survive.  That argues against the lets just let everyone get it strategy. 

[redcatcherb412]

If you have a family member who sews it isn't hard to produce your own masks.  About mid-March it became obvious this was going to last a while and masks would be needed.    I ordered material and sent to my mom who sews and she downloaded some patterns off the internet and made some prototypes. 

She said the pleated ones were actually easier to make and easier to get a good fit on the face than the cup shaped.  All of these have an extra pocket for a sheet of paper towel or tissue as a disposable filter layer.  They say a sheet of that blue paper towel material like mechanics use has a filter almost as good as N95.  She also got fancy and sewed in a piece of florist wire across the nose bridge of each.  I wonder where I inherited my obsessive-compulsion from. 

She is going to send me those prototypes to try out and then we should have enough fabrics to get masks to our family members.  I'm suspecting the pleated tie strap version is going to be best.  I hear hospitals are preferring those for donated homemade masks as they are more durable and can fit a wider range of head sizes tightly.  More adjustable.

Get those sewing machines rolling. Homemade masks are the new Victory Garden.



(Image removed from quote.)

Mask studies, they cannot make up their minds what's best. 

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4420971/

From the above study summation
We have provided the first clinical efficacy data of cloth masks, which suggest HCWs should not use cloth masks as protection against respiratory infection. Cloth masks resulted in significantly higher rates of infection than medical masks, and also performed worse than the control arm. The controls were HCWs who observed standard practice, which involved mask use in the majority, albeit with lower compliance than in the intervention arms. The control HCWs also used medical masks more often than cloth masks. When we analysed all mask-wearers including controls, the higher risk of cloth masks was seen for laboratory-confirmed respiratory viral infection.

Laboratory tests showed the penetration of particles through the cloth masks to be very high (97%) compared with medical masks (44%) (used in trial) and 3M 9320 N95 (less than 0.01%), 3M Vflex 9105 N95 (0.1%).


So who is right CDC, NIH ? Time will tell, but if you think a mask is the catch all then by all means use them.

[CptTrips]

So who is right CDC, NIH ? Time will tell, but if you think a mask is the catch all then by all means use them.

Your're confused and missing the point.

HCW (Health Care Workers)  Should have N-95 masks.   When there are all the N-95 mask the HCW need  and more available, everyone else should use them too.  In the meantime, for those that aren't HCW, a cloth mask offers better protection than breathing the virus directly down into your unprotected lungs.

But I would encourage you and your family not to use any masks at all if you and not comfortable.

[Eagler]

Bustr

Your comments sound like the  virus was humanly manipulated which can also be called weaponized

<S>

Eagler

[Busher]

Bustr

Your comments sound like the  virus was humanly manipulated which can also be called weaponized

<S>

Eagler

I saw nothing to suggest that. It's a genetic code.

But considering that polls suggest that 29% of us seem to want to believe that this was an attack, this post might be enlightening; all research from western immunologists.

https://www.sciencenews.org/article/coronavirus-covid-19-not-human-made-lab-genetic-analysis-nature