Aces High Bulletin Board

General Forums => The O' Club => Topic started by: SysError on April 05, 2020, 05:49:10 PM

Title: Covid 19 Prevention discussion ONLY
Post by: SysError on April 05, 2020, 05:49:10 PM
I started this topic to discuss COVID-19 PREVENTION ISSUES ONLY

If you want to talk about who started it, who failed to see it coming, who has the cure, how many are going to die, why Jesus Christ is going to come down from the heavens above and just take care of business, fine, just start your own topic.

------------------

Worrying development (and some good news):

https://covidpapers.github.io/posts/stability-of-sars-cov-2-in-different-environmental-conditions/

Quote
This paper also shows that the SARS-CoV-2 can be stable on the inner and outer layer of masks up to 7 days. If it is not used appropriately and/or for long periods or binned inappropriately it could be a serious source of infection

Quote
More on stability of virus causing #COVIDー19. Key points:
<3 hrs paper, <4 d glass, <7 d steel & plastic;
Found on surgical mask on day 7;
Stable across pH 3-10;
Inactivated by heat (5 mins at 70C), bleach, ethanol, povidone‐iodine, benzalkonium chloride


(I will copy and paste some of the more informative posts from other threads in due course).
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TequilaChaser on April 05, 2020, 06:02:52 PM
I spent 4 hours today taking masks & sterile medical gloves from our family stock and passing them out to my elderly neighbors....

I'm fortunate to have such a supply thanks to my oldest daughter, Sister and her 3 daughters all worked in the medical field......2 of my nieces still do

Neighbors asked me how much I wanted, told them nothing and to call if I could be of help
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 05, 2020, 06:13:12 PM
I sincerely with you luck with this thread.

Since viruses cannot be cured, the only thing we can do is stop the spread. That equates to as little human interaction as possible. When science releases an effective vaccine hopefully the disease will be eradicated as efficiently as small pox and polio.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Spikes on April 05, 2020, 06:15:21 PM
Well I give this 4 pages.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 05, 2020, 06:18:10 PM
I spent 4 hours today taking masks & sterile medical gloves from our family stock and passing them out to my elderly neighbors....

I'm fortunate to have such a supply thanks to my oldest daughter, Sister and her 3 daughters all worked in the medical field......2 of my nieces still do

Neighbors asked me how much I wanted, told them nothing and to call if I could be of help

 :salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hazmatt on April 05, 2020, 06:46:29 PM
Does anybody have an knowledge of when the peak is actually expected?

I've seen so many charts and predictions that are all different that my eyes glaze over when I see a new one.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 05, 2020, 06:48:12 PM
https://www.cdc.gov/coronavirus/2019-ncov/prevent-getting-sick/diy-cloth-face-coverings.html
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 05, 2020, 06:53:50 PM
Michigan Nurse Demonstrates How Easy Coronavirus Cross-Contamination Can Be

Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 05, 2020, 07:05:43 PM
Does anybody have an knowledge of when the peak is actually expected?

I've seen so many charts and predictions that are all different that my eyes glaze over when I see a new one.

It is really going to depend on where you live.

My wife uses this site.  Others may have their own trusted source(s).

https://coronavirus.1point3acres.com/

(you can drill down to the county level)
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 05, 2020, 07:07:39 PM
Does anybody have an knowledge of when the peak is actually expected?

I've seen so many charts and predictions that are all different that my eyes glaze over when I see a new one.


Which peak?  This first one?  I think Apr 16'ish is what I read.


By state (ONLY ESTIMATES OF COURSE)

https://thehill.com/changing-america/well-being/prevention-cures/490856-when-will-coronaviruses-cases-peak-in-your-state (https://thehill.com/changing-america/well-being/prevention-cures/490856-when-will-coronaviruses-cases-peak-in-your-state)
Title: Re: Covid 19 Prevention discussion ONLY
Post by: perdue3 on April 05, 2020, 07:35:39 PM
I am not going to say that it is air tight. But it is pretty much air tight.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Volron on April 05, 2020, 07:52:18 PM

Which peak?  This first one?  I think Apr 16'ish is what I read.


By state (ONLY ESTIMATES OF COURSE)

https://thehill.com/changing-america/well-being/prevention-cures/490856-when-will-coronaviruses-cases-peak-in-your-state (https://thehill.com/changing-america/well-being/prevention-cures/490856-when-will-coronaviruses-cases-peak-in-your-state)

With what I'm seeing here, May 6th is a bit early for TX.   :noid
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Copprhed on April 05, 2020, 07:58:03 PM
They have now found tigers with respiratory issues that tested positive for Novel Corona virus, and also have found that Covid 19 can present as pink eye.
https://abcnews.go.com/Health/wireStory/tiger-nycs-bronx-zoo-tests-positive-coronavirus-69989185
https://www.aao.org/headline/alert-important-coronavirus-context
Title: Re: Covid 19 Prevention discussion ONLY
Post by: 100Coogn on April 05, 2020, 08:15:18 PM
Wow, a 5th thread on this subject...
I miss Skuzzy.

Coogan

Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 05, 2020, 08:19:04 PM
With what I'm seeing here, May 6th is a bit early for TX.   :noid

Who knows.  Estimates are just estimates based on conditions that are constantly changing.
That doesn't mean you don't make estimates.  You have to for planning purposes. You have to make an informed best guess to predict what you are going to have to be ready for.

Businesses operate on reasonable estimates all day, every day.  If you are not estimating, you are flying blind in pure reaction mode.

I'd wager we'll have two more "peaks" before we get a vaccine caused by multiple attempts of lifting quarantine.  Probably Sept and Jan.  Hopefully each will be less than the previous as people slowly learn the hard way to be careful and hopefully we will have developed some palliative treatments. 

:salute



Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 05, 2020, 08:19:45 PM
Wow, a 5th thread on this subject...
I miss Skuzzy.

Coogan

Did someone force you to open it?
Title: Re: Covid 19 Prevention discussion ONLY
Post by: 100Coogn on April 05, 2020, 08:49:03 PM
Did someone force you to open it?

No.

Coogan
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 05, 2020, 08:49:46 PM

On the good news side, Italy is finally seeing some traction from their extreme quarantine measures:

https://www.cnn.com/world/live-news/coronavirus-pandemic-04-05-20/h_38b2305e063290ed0cb34b29d48bae60 (https://www.cnn.com/world/live-news/coronavirus-pandemic-04-05-20/h_38b2305e063290ed0cb34b29d48bae60)

and it looks like the US numbers are ever so slightly bending down. Like by a hair.  I think we are seeing the beginnings of our quarantine measures.

Quarantine works.  It's how China got their problem under control (and we'll probably never know how large their problem really was).  It's worked in Singapore and Hong Kong.

However, that only holds for as long as you hold the quarantine.  The second you try and relax it, things start up again at exponential speed because that's how virus' work. 

https://www.cnn.com/2020/03/23/asia/hong-kong-coronavirus-quarantine-intl-hnk/index.html (https://www.cnn.com/2020/03/23/asia/hong-kong-coronavirus-quarantine-intl-hnk/index.html)

:salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: 100Coogn on April 05, 2020, 09:03:35 PM
See rule #4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 05, 2020, 09:05:00 PM
See rule #4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 05, 2020, 09:17:35 PM
See rule #4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 05, 2020, 09:23:45 PM
See rule #4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 05, 2020, 09:36:32 PM
See rule #4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 05, 2020, 09:50:10 PM
Ya... kinda figured that.

Just put them on the ignore list and keep on truckin.
I just wish Hitech would put a button directly under the avatar so I don't have to keep going to my profile page.
 
(But having a shortcut link on my desktop is almost as good.  It's been getting a lot of use lately.)

 :salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Oldman731 on April 05, 2020, 09:54:27 PM
The source of your information explains a lot about you.


And there we go!  Not quite a full two pages.

- oldman
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Meatwad on April 05, 2020, 10:12:43 PM
 :bhead
Title: Re: Covid 19 Prevention discussion ONLY
Post by: DaddyAce on April 05, 2020, 10:36:01 PM
Here's the U WA site that models the peaks for the country & states:

 https://covid19.healthdata.org/projections

This site displays more than the peak estimates, including when the states instituted various measures to control spread.   I won't get into politics, but it is interesting to see which state leaders took action when, and see how things play out in those states....not that the quality of leadership is the whole story by any means....
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 06, 2020, 07:21:04 AM
See rule #4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 06, 2020, 07:38:29 AM
Stay home

Stay away from old ppl

Turn off the news and the stupid side of social media

Enjoy your family and appreciate this opportunity for what it is- time to bond with the ones you love the most

<S>

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Zimme83 on April 06, 2020, 07:56:50 AM
- Wash your hands with soap and water for at least 20 seconds.
- Maintain at least 2m distance to other
- avoid visit persons with a risk factor
- Dont touch your face
- Stay home if you have any symptom at all.

On a national level  compliance is more important than what interventions you have on paper. No intervention works if people arent following them.

Take this toejam seriously, listen to the experts, they are experts for a reason. do what you can to protect yourself and others.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 06, 2020, 09:15:18 AM
From here on out any who bring politics in to these type of discussions will get mutt for about a  week.

HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 06, 2020, 10:28:01 AM
Stay home

Stay away from old ppl

Turn off the news and the stupid side of social media

Enjoy your family and appreciate this opportunity for what it is- time to bond with the ones you love the most

<S>

Eagler

Good advice all.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Puma44 on April 06, 2020, 10:37:48 AM
From here on out any who bring politics in to these type of discussions will get mutt for about a  week.

HiTech

To quote HiTech, IN.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 06, 2020, 10:39:26 AM
To quote HiTech, IN.

What's IN?
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 06, 2020, 10:42:42 AM
What's IN?

Opposite of out.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Puma44 on April 06, 2020, 11:23:04 AM
What's IN?

...before the lock.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 06, 2020, 11:23:37 AM
Take this toejam seriously, listen to the experts, they are experts for a reason. do what you can to protect yourself and others.

Thank you.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 06, 2020, 11:48:44 AM
Think it's getting bad?  It's probably worse than you've been told.

https://www.nytimes.com/2020/04/05/us/coronavirus-deaths-undercount.html?utm_source=The+Bulwark+Newsletter&utm_campaign=faa40c954f-EMAIL_CAMPAIGN_2020_04_06_01_24&utm_medium=email&utm_term=0_f4bd64ac2e-faa40c954f-79959529 (https://www.nytimes.com/2020/04/05/us/coronavirus-deaths-undercount.html?utm_source=The+Bulwark+Newsletter&utm_campaign=faa40c954f-EMAIL_CAMPAIGN_2020_04_06_01_24&utm_medium=email&utm_term=0_f4bd64ac2e-faa40c954f-79959529)

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 06, 2020, 11:50:46 AM
Think it's getting bad?  It's probably worse than you've been told.

*link snipped*

Very bad news for coroners and undertakers.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 06, 2020, 11:56:32 AM
Very bad news for coroners and undertakers.

The should treat every body like a gun.  Just assume it's loaded regardless of what the paper work says.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 06, 2020, 12:00:04 PM
Wife and I were just saying the other day that this could result in a mandatory 'seal and cremate' law for the duration.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 06, 2020, 12:09:02 PM
Wife and I were just saying the other day that this could result in a mandatory 'seal and cremate' law for the duration.

They need to stop sending bodies to funeral home completely.  All you're doing is moving contamination around your city.

Park FEMA diesel powered mobile crematoriums mounted on 18-wheels behind the hospitals and run them 24/7.  Bodies should not leave the hospital premises. 
 
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 06, 2020, 12:20:29 PM
Park FEMA diesel powered mobile crematoriums mounted on 18-wheels behind the hospitals and run them 24/7.   

Do those exist?  :O
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 06, 2020, 12:37:11 PM
Do those exist?  :O

If they don't, then someone should be fired for incompetence.  There are a ton of scenarios like earthquakes where mass deaths would overload local handling facilities.

I know the technology exists.  It's not complicated.  An incinerator and a fuel tank bolted onto an 18-wheeler.  I've seen various reports over the years in other countries:
https://i.insider.com/5564799ceab8ea496e1bb2d8?width=700&format=jpeg&auto=webp (https://i.insider.com/5564799ceab8ea496e1bb2d8?width=700&format=jpeg&auto=webp)
http://www.shadolsonshow.com/2020/02/19/amid-mass-cremation-fears-china-delivers-another-40-giant-incinerators-to-wuhan/ (http://www.shadolsonshow.com/2020/02/19/amid-mass-cremation-fears-china-delivers-another-40-giant-incinerators-to-wuhan/)

Supposedly there were something like 40 sent to Wuhan.  I don't know if that were true (Sources seem sketchy.), but if I were head of FEMA I'd make sure we had a fleet of them for a hundred different reasons.  Like this one.  :cry
 
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 06, 2020, 01:00:55 PM
I don't think our legal system and its armies of lawyers will  let you cremate granny on hospital grounds without a fight

This ain't China

<S>

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: perdue3 on April 06, 2020, 01:33:41 PM
But, they will only allow 10 people to attend the funeral for Granny, which is worse?
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 06, 2020, 01:35:15 PM
I don't think our legal system and its armies of lawyers will  let you cremate granny on hospital grounds without a fight

I don't think there would be any particular difficulty when the needs for public safety are primary.

The same way they can fine or arrest you for violating Shelter-in-Place orders.

All it takes is a piece of paper. Even a local county judge can sign that and put it in force.  Certainly a Governor declaring a state emergency.  Certainly a President declaring a national emergency.

This is not politics BTW.  Officials of both parties will be signing public safety orders of various types and they will be enforced for the common good.

:salute

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 06, 2020, 01:39:43 PM
The should treat every body like a gun.  Just assume it's loaded regardless of what the paper work says.

Holy crap.... did hell freeze over?

I agree completely. LOL
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TheBug on April 06, 2020, 01:53:05 PM
Is Mutt a big dog or a little dog?
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 06, 2020, 02:12:50 PM
On the good news side, Italy is finally seeing some traction from their extreme quarantine measures:

https://www.cnn.com/world/live-news/coronavirus-pandemic-04-05-20/h_38b2305e063290ed0cb34b29d48bae60 (https://www.cnn.com/world/live-news/coronavirus-pandemic-04-05-20/h_38b2305e063290ed0cb34b29d48bae60)

and it looks like the US numbers are ever so slightly bending down. Like by a hair.  I think we are seeing the beginnings of our quarantine measures.

Quarantine works.  It's how China got their problem under control (and we'll probably never know how large their problem really was).  It's worked in Singapore and Hong Kong.

However, that only holds for as long as you hold the quarantine.  The second you try and relax it, things start up again at exponential speed because that's how virus' work. 

https://www.cnn.com/2020/03/23/asia/hong-kong-coronavirus-quarantine-intl-hnk/index.html (https://www.cnn.com/2020/03/23/asia/hong-kong-coronavirus-quarantine-intl-hnk/index.html)

:salute


Maybe more good news.

It could be noisy data, but maybe we are just starting to see some effects to our quarantine...

New cases:
(https://www.dropbox.com/s/hf05gijrblqxdmu/us-new_cases.png?raw=1)

New deaths:
(https://www.dropbox.com/s/0puyhzp81mirldi/us-new%20deaths.png?raw=1)


Quarantines definitely work for as long as you can maintain them.  But the virus hasn't gone away.  It's just sitting there hoping to out-wait you then it's off to the races again.  :bhead






Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 06, 2020, 02:51:28 PM
Graphs makes no sense to me, deaths should lag new cases.

HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 06, 2020, 02:57:47 PM
Graphs makes no sense to me, deaths should lag new cases.

Correct.  And it's only a one day decrease.  I'm not suggesting you can take that to the bank. 

However, it could also be that the "true" new cases has been already decreasing since the start of the quarantine, and the graphed new cases is just showing the effect of stepped up testing recording additional people who were already sick. 

There are a lot of moving parts.  We'll just have to see if the blip develops in to a sustainable trend. 

:salute

Title: Re: Covid 19 Prevention discussion ONLY
Post by: TequilaChaser on April 06, 2020, 03:05:52 PM
Well,.at least I don't have to do any of my monthly Doctors visits looking like August they told me today.....

And they will be delivering all my meds to the house, including my narcotics.....double yay!
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 06, 2020, 03:11:27 PM
However, it could also be that the "true" new cases has been already decreasing since the start of the quarantine, and the graphed new cases is just showing the effect of stepped up testing recording additional people who were already sick. 

This is what I would bet on , but Like we said be for we really need a random sampling of some area using both anti body and antigen test to be able to know what is going on.

In MHO this should be at the top of the lists of priorities. With a 1 - 10k sampling of an area of NY, a clear view would emerge. For all we know we could already be at 50% infected in some areas.

HiTech

Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 06, 2020, 03:12:54 PM
Well,.at least I don't have to do any of my monthly Doctors visits looking like August they told me today.....

And they will be delivering all my meds to the house, including my narcotics.....double yay!

Heh.  Good! 

You know what I got in the mail yesterday?  A notice I had to go in and get my drivers license renewed in person.  I wasn't eligible to do it online again.

But I checked and there is a state decree that all drivers license expirations after Mar 13 are waived until further notice.   :D

Whew!  I couldn't imagine anything more like a scene from a Stephen King novel than having to go to the DMV during a pandemic.  :rofl



Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 06, 2020, 03:32:16 PM
Heh.  Good! 

You know what I got in the mail yesterday?  A notice I had to go in and get my drivers license renewed in person.  I wasn't eligible to do it online again.

But I checked and there is a state decree that all drivers license expirations after Mar 13 are waived until further notice.   :D

Whew!  I couldn't imagine anything more like a scene from a Stephen King novel than having to go to the DMV during a pandemic.  :rofl

I'm restricted to driving back and forth to the fridge.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 06, 2020, 03:34:26 PM
This is what I would bet on , but Like we said be for we really need a random sampling of some area using both anti body and antigen test to be able to know what is going on.

In MHO this should be at the top of the lists of priorities. With a 1 - 10k sampling of an area of NY, a clear view would emerge. For all we know we could already be at 50% infected in some areas.

HiTech


Maybe.  I certainly would like both test as widely available ASAP.  Testing is cheap relatively speaking.  Testing at least is something we CAN do in the short term while waiting on a vaccine. 


I do wonder though.  I have seen reports of it mutating. (40 different mutations? )  I have seen reports of people testing positive for multiple strains simultaneously.  I have seen reports of people getting re-infected after recovering.  (Same strain?  Mutation?  Same infection just flared back up?)

So if you show anti-bodies for a previous strain, does that mean you are also immune to all all other and all future strains?

I'm sure the scientists are taking this into account but I'm curious.

:salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 06, 2020, 03:57:42 PM
Hoping not to sound political as I don't want to be a mutt but I find the death count as mainly an incomplete reference to be used to keep us scared, uninformed and in our houses

Where is the data that shows what the age of the dead were?

What pre existing conditions did they have?

Are the majority half dead to start with?

What date did they feel sick?

What symptoms did they have?

When and where did they think they got it from?

How did the sickness progress?

When how many days before they were admitted to a hospital?

Did they go to ICU? Did they require a  ventilator?

From sick to dead how many days?

Also would like the stats on all of the recovered ones

Without facts and details one is left to trust some talking head who may or may not have an agenda

Has anyone found the above info anywhere?

I have not

The only thing the dead count does if provide a very vague reference to see if more or less are dying from one day to the  next and that is only if everyone is accurate in their reporting

<S>

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 06, 2020, 04:00:03 PM

Maybe.  I certainly would like both test as widely available ASAP.  Testing is cheap relatively speaking.  Testing at least is something we CAN do in the short term while waiting on a vaccine. 


What I speak of could be done very quickly (like in days) with just 1000 random samples (think polling) antibody tests.  I believe I heard that an anti body test has been developed. And I'm not talking about the need to produce large quantities, then we  finally would have an accurate measure of the denominator.

I do wonder though.  I have seen reports of it mutating. (40 different mutations? )  I have seen reports of people testing positive for multiple strains simultaneously.  I have seen reports of people getting re-infected after recovering.  (Same strain?  Mutation?  Same infection just flared back up?)

If reinfection is possible, then there is not any hope for a vaccine. I had read some stuff about 2 possible strains. But any mutation (i.e. new strain) almost always cancels out any immunity.  The 40 mutation does not sound very plausible considering normal mutation virus rates.

HiTech


HiTEch
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Spikes on April 06, 2020, 04:00:12 PM
Hoping not to sound political as I don't want to be a mutt but I find the death count as mainly an incomplete reference to be used to keep us scared, uninformed and in our houses

Where is the data that shows what the age of the dead were?

What pre existing conditions did they have?

Are the majority half dead to start with?

What date did they feel sick?

What symptoms did they have?

When and where did they think they got it from?

How did the sickness progress?

When how many days before they were admitted to a hospital?

Did they go to ICU? Did they require a  ventilator?

From sick to dead how many days?

Also would like the stats on all of the recovered ones

Without facts and details one is left to trust some talking head who may or may not have an agenda

Has anyone found the above info anywhere?

I have not

The only thing the dead count does if provide a very vague reference to see if more or less are dying from one day to the  next and that is only if everyone is accurate in their reporting

<S>

Eagler
This.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 06, 2020, 04:13:26 PM
What pre existing conditions did they have?

Are the majority half dead to start with?

https://bbs.hitechcreations.com/smf/index.php/topic,399049.msg5294612.html#msg5294612

https://bbs.hitechcreations.com/smf/index.php/topic,399049.msg5295172.html#msg5295172
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 06, 2020, 04:24:22 PM
What I speak of could be done very quickly (like in days) with just 1000 random samples (think polling) antibody tests.  I believe I heard that an anti body test has been developed. And I'm not talking about the need to produce large quantities, then we  finally would have an accurate measure of the denominator.

I know they are close to an anti-body test.  I don't know if it is being used yet.  I agree.  Epidemiologist have various sampling algorithm to give them a reasonable clear picture with a minimum of tests.  Kinda like Six Sigma Design of Experiment techniques.

Antigen tests are different matter.  We need to be massively testing everywhere to catch asymptomatic super-spreaders and get them isolated so we don't keep digging the hole we are trying to get out of.

I don't know if mutations equate to different strains technically. I don't know if they have enough in common that a vaccine can have effectiveness across the variations.  I can't answer those questions.  We do have to keep changing the Flu vaccine because it keeps mutating.  Subsequent vaccine versions are not as hard as the first one because the year variations are generally not massive.

(NYPost isn't my favorite source but I doubt they are lying...)
https://nypost.com/2020/03/24/iceland-scientists-found-40-mutations-of-the-coronavirus-report-says/ (https://nypost.com/2020/03/24/iceland-scientists-found-40-mutations-of-the-coronavirus-report-says/)

I haven't decided how to feel about the possibility of a quickly mutating virus.  On one hand it makes it very hard to develop a vaccine or do meaningful anti-body testing.

On the other hand, the economies of transmission dictate that over time a virus will become more infectious, but less deadly. There is no economic benefit in a virus killing it's host.  Killing the host is not an intended feature of a virus, it's a bug. (See what I did there?  ;))  So if it's quickly mutating, maybe it quickly mutates to a less deadly form. 

But it doesn't always work that way.  some times the virus screws up.  The second wave of the Spanish Flu that came back in the Fall was much more deadly.  The majority of the 20 million deaths occurred in that phase.

:salute







 
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TequilaChaser on April 06, 2020, 04:59:12 PM

If reinfection is possible, then there is not any hope for a vaccine. I had read some stuff about 2 possible strains.
But any mutation (i.e. new strain) almost always cancels out any immunity.  The 40 mutation does not sound very plausible considering normal mutation virus rates.

HiTech

It has been confirmed for several months now that there are 2 different strands of covid19.....1 is mild with symptoms the other a lot deadlier


TC
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 06, 2020, 05:06:03 PM
It has been confirmed for several months now that there are 2 different strands of covid19.....1 is mild with symptoms the other a lot deadlier

8 strains (at least).

https://www.usatoday.com/story/news/nation/2020/03/27/scientists-track-coronavirus-strains-mutation/5080571002/
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TequilaChaser on April 06, 2020, 05:17:37 PM
8 strains (at least).

https://www.usatoday.com/story/news/nation/2020/03/27/scientists-track-coronavirus-strains-mutation/5080571002/

Ok, 8 now if they are being truthful   :D

Ya know, this stuff don't bother or scare me one bit because HE is my protector
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TequilaChaser on April 06, 2020, 05:57:38 PM
Heh.  Good! 

You know what I got in the mail yesterday?  A notice I had to go in and get my drivers license renewed in person.  I wasn't eligible to do it online again.

But I checked and there is a state decree that all drivers license expirations after Mar 13 are waived until further notice.   :D

Whew!  I couldn't imagine anything more like a scene from a Stephen King novel than having to go to the DMV during a pandemic.  :rofl





Don't forget about that new federal ID requirement that kicks in on October 1st, 2020 because of that damn bill the government passed back in 2004, iirc
Title: Re: Covid 19 Prevention discussion ONLY
Post by: guncrasher on April 06, 2020, 07:18:23 PM
Don't forget about that new federal ID requirement that kicks in on October 1st, 2020 because of that damn bill the government passed back in 2004, iirc

real I'd has a 1 year extension.


semp
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 07, 2020, 12:58:04 PM

Maybe more good news.

It could be noisy data, but maybe we are just starting to see some effects to our quarantine...



Welp, there goes that theory.


Haven't even had lunch yet and new deaths are already 1,371.

Of course, given the progression time, those were probably infected before the quarantine.  If you assume an average 30 cycle we probably won't really be seeing the real benefits of a quarantine for another week.  I jsut thought maybe we were catching a lucky break for a change.

See, that's what I get for trying to be optimistic.  ;)



Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 07, 2020, 04:44:00 PM
Strange chart.
I well understand that it could be showing opposite causation but it could also be showing stay at home raises the number of cases.

https://twitter.com/AlexBerenson/status/1247500508841025542

HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 07, 2020, 05:26:11 PM
Strange chart.
I well understand that it could be showing opposite causation but it could also be showing stay at home raises the number of cases.

https://twitter.com/AlexBerenson/status/1247500508841025542

HiTech

That chart isn't compelling to me.  If fact in my opinion, that chart is attempting to be intentionally misleading.

The attempt is to compare the drop off in activity to when the Pandemic was declared.  If you remember, it was obvious to everyone we are already well into the Pandemic before it was officially declared.  If you remember there was quite a bit of consternation about why the F* the WHO hadn't already declared the obvious.  The drop off in activity after that was simple closing the barn door after the horse got out.

A more honest chart would be to graph the increase of COVID-19 hospitalizations over that chart.  I suspect you would see COVID-19 hospitalization climbing well before the Pandemic was declared or those countries decided to desperately slam the barn door shut. 

Where the F* is Lusche when the world needs him!

:salute

[Edit]  The people dying the last couple of weeks in Italy where people probably infected in early-mid February.  He didn't even bother to cover the early Feb period, but look at the activity in Mid-Feb of Italy compared to S. Korea.

Spain had just gotten through with some big festival the had even though cases were already climbing (can't remember the name. ).

 
(https://www.dropbox.com/s/y7nz8h2jc6uk9jh/italy-.png?raw=1)


And I know that guy.  I don't consider him a trustworthy source.  He has a reputation.  But that's as far as I can go under your rules.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 07, 2020, 07:52:11 PM
I really find this guys vids interesting.  They have become a daily ritual in the evenings. 

It only 30 min long, but if you are in a hurry hit these points:

14:40 - Minimal conditions for responsibly easing quarantine.

16:45 - Stuff he says makes me think he doesn't consider the variations a barrier to acquired immunity.

17:50 - Have we had silent infections?  Approaching herd immunity?

20:35 - Confirms my suspicions that starting with actual observed deaths and working backwards is cleaner data.

22:04 - Modeling estimates.  Yeah I know...modeling, but tell me businesses don't rely on modeling and estimates.  (Note:  Herd immunity would require ~80% infection distribution. )

24:26 - Bad news on anti-body testing.  3 months????


Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 07, 2020, 09:23:00 PM
Per presidential brief today antibody testing has already started.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 07, 2020, 09:34:56 PM
Wow, is it just me? I thought we were getting mutted if we brought politicians into any part of this :devil
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 07, 2020, 09:40:39 PM
Per presidential brief today antibody testing has already started.

Yeah?  Which one said it?  :rofl

If it's true, that's good news.  Let's hope they do better than with their first test kits.

:salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 07, 2020, 10:02:45 PM
OK.  Awesome.  It looks like our antibody testing has started. Hopefully those are successful.  Hopefully the Brits recover quickly.

It looks like initially the focus will be on identifying medical personnel who are at least risk to care for infected. 

Hopefully other are planning a more systematic sampling to answer some of our open questions.


Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 07, 2020, 11:41:00 PM

Welp, there goes that theory.


Haven't even had lunch yet and new deaths are already 1,371.

Of course, given the progression time, those were probably infected before the quarantine.  If you assume an average 30 cycle we probably won't really be seeing the real benefits of a quarantine for another week.  I jsut thought maybe we were catching a lucky break for a change.

See, that's what I get for trying to be optimistic.  ;)

Yet, still hope.  New cases still have not risen above the 4th. 

(https://www.dropbox.com/s/fa39u8nb82iabfj/new_cases.png?raw=1)

First time so far we've had 3 days lower than a previous high.

However as bad as the daily count is, the number that creeps me out more is the Deaths:Recovered.  I've been expecting the Recovered to eventually dominate more.  Its been holding pretty consistent at 40%:60%.  If we don't get some treatment to alter that trend,  that would suggest maybe 160k additional deaths as the current 400,540 cases resolve over the next month.

I'm not sold on hydroxychloroquine yet, but we need to find something that gets us some leverage on this thing.

:salute










Title: Re: Covid 19 Prevention discussion ONLY
Post by: 1stpar3 on April 08, 2020, 02:35:53 AM
Yet, still hope.  New cases still have not risen above the 4th. 

(https://www.dropbox.com/s/fa39u8nb82iabfj/new_cases.png?raw=1)

First time so far we've had 3 days lower than a previous high.

However as bad as the daily count is, the number that creeps me out more is the Deaths:Recovered.  I've been expecting the Recovered to eventually dominate more.  Its been holding pretty consistent at 40%:60%.  If we don't get some treatment to alter that trend,  that would suggest maybe 160k additional deaths as the current 400,540 cases resolve over the next month.

I'm not sold on hydroxychloroquine yet, but we need to find something that gets us some leverage on this thing.

:salute
Not Sold on Hydroxy Chloroquine? I am leaning in that direction. When a Dem House Member says it works and "Saved her life" and "THANK YOU TRUMP"....It gives me hope that this division among folk aint as bad as it seems
Title: Re: Covid 19 Prevention discussion ONLY
Post by: LLv34_Snefens on April 08, 2020, 05:33:42 AM
The inherent problem with anecdotes about succesful treatment methods for potential deadly diseases, is that there is a strong survivor bias to them all.
You don't hear the anecdotes from the people who died, even if they got the same treatment.

I am talking generally here and not particular about hydroxychloroquine. What you really need to be sure is proper blind testing, but that of course takes time, which is in short supply.
In regards to hydroxychlorquine such test have just started here in Denmark, but final results are not expected until after summer.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Zimme83 on April 08, 2020, 09:00:18 AM
See rule #14
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 08, 2020, 09:03:19 AM
This morning they said that professionals are estimating a peak around April 15.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 08, 2020, 10:27:01 AM
Getting back to the topic of a prevention discussion ...

Brooke on March 22, 2020, 02:56:31 PM put it well:

Quote
In my family, there were some doctor visits scheduled for non-essential things (looking at a sore shoulder) and some more-essential things (regarding necessary medications).

We cancelled the non-essential ones, but we are keeping the more-essential ones subject to the following steps.

Family member will:
-- Wear n95 mask from time of exiting car onward.
-- Not rub eyes, pick nose, or touch face during visit.
-- Keep separation from other people as possible.
-- Thoroughly disinfect hands with sanitizer after visit before touching car keys, door handle, etc., or entering car.
-- Once home, take off mask by straps and dispose in outside trash.
-- Disinfect hands again before touching door knob to enter house.
-- Upon entry to house, take off shoes and clothes.
-- Clothes go right into open washing machine.
-- Travel right to location of next step without touching anything else in house.
-- Wash hands and face with soap and water, or better yet take a shower.
-- Put on fresh clothes.
-- Go back and close the washing machine and start it washing.
-- Use alcohol to rub down any credit or medical cards used, then wash hands.

I do some of these steps even for visiting the gas station with no-one else around me, namely:
-- Not rub eyes, pick nose, or touch face during visit.
-- Thoroughly disinfect hands with sanitizer after visit before touching car keys, door handle, etc., or entering car.
-- Disinfect hands again before touching door knob to enter house.
-- Use alcohol to rub down any credit cards used, then wash hands.
[/size][/size][/size]
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 08, 2020, 10:28:55 AM
Removing Gloves Properly and Safely Technique | How to Remove Gloves

Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 08, 2020, 10:45:37 AM
See rule #14

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Spikes on April 08, 2020, 11:22:14 AM
This morning they said that professionals are estimating a peak around April 15.
They said the same weeks ago too, not much has changed which I suppose is a good thing.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 08, 2020, 11:38:50 AM
I wanted to highlight this link again.

https://covidpapers.github.io/posts/stability-of-sars-cov-2-in-different-environmental-conditions/

As more research comes in on the survival characteristics of this thing, subtle but important changes in how long, under what conditions, and on what types of surfaces this thing survives on are being published.

Among important recent updates/changes to keep in mind is that:

“SARS-CoV-2 can be stable on the inner and outer layer of masks up to 7 days”

It was also found to be stable on stainless steel and plastic for up to 4 days.


In other words, keeping your groceries for 3 days in the garage may not be enough time all cases.


Even more important, however, is to keep in mind the temperature:

At 39.2 F (4C), about the temperature of the inside of refrigerator, this thing does not appear to die off.

At 71.6F (22C), (a nice summer day), it can take up to 7 days for the virus to “die”

At 98.6F (37C), (a hot summer day), it can take up to a day for the virus to “die”



What I take from this is that when we bring home a gallon of milk, that unless we bath the container in bleach for 6 minutes, we shouldn’t consider it sterile.

(BTW: this is from and for Clorox products.  Adjust as needed for the brand you have access to.)

https://www.clorox.com/how-to/disinfecting-sanitizing/cold-flu-other-diseases/how-to-make-your-own-disinfecting-solution/

(On the general topic of food: https://www.consumerreports.org/food-storage/how-to-extend-food-expiration-dates/ )

The only item that has me puzzled is the data on the effectiveness of hand soap.  I’ll try to talk to someone who might be able shed some light on that data set and post an update if/when I can.

Stay Safe!

Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 08, 2020, 11:57:44 AM
PSA Grocery Shopping Tips in COVID-19



Note:  please see post above about updated time/temp studies.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: BoilerDown on April 08, 2020, 12:03:33 PM


We're don't go back to a semblance of normal until there's a vaccine, which means 18 months from now.  Don't fool yourselves.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 08, 2020, 12:14:18 PM
Bless that doc for offering a video to help ensure our food is Covid-19 free but maintaining a sterile field in surgery is more in-depth than what he portrayed. Granted, there is no way to mimic those practices exactly without the supplies and equipment needed to do so (autoclave, clean room, several changes of gloves, pre-sterilized and wrapped gowns, etc.) but his being glove and mask free and wiping the lettuce everywhere but where he held/touched it made me wince a bit.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 08, 2020, 12:24:34 PM


We're don't go back to a semblance of normal until there's a vaccine, which means 18 months from now.  Don't fool yourselves.

Thanks.  That was an intelligent discussion.
 :salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Firetech on April 08, 2020, 12:44:48 PM
See rule #14
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 08, 2020, 12:48:12 PM
See rule #14
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 08, 2020, 12:57:01 PM
Bless that doc for offering a video to help ensure our food is Covid-19 free but maintaining a sterile field in surgery is more in-depth than what he portrayed. Granted, there is no way to mimic those practices exactly without the supplies and equipment needed to do so (autoclave, clean room, several changes of gloves, pre-sterilized and wrapped gowns, etc.) but his being glove and mask free and wiping the lettuce everywhere but where he held/touched it made me wince a bit.

I take your point.  There were a couple of things that made me "wince" too, however, I think that he had to assume the LCD in terms of supplies.  I am not sure that I saw anything that was off the charts "bad" though.  (I think that soaking items in a bath solution is a better bet, but that is me).

Does anyone know of a better vid?  If so please post.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 08, 2020, 01:08:28 PM
I take your point.  There were a couple of things that made me "wince" too, however, I think that he had to assume the LCD in terms of supplies.  I am not sure that I saw anything that was off the charts "bad" though.  (I think that soaking items in a bath solution is a better bet, but that is me).

Does anyone know of a better vid?  If so please post.

I think those measures certainly beat none. I keep daydreaming about a 3 ft by 3 ft UV sanitation grocery receiver box. Granted, that becomes a measure for 'who can afford it' if deemed effective.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 08, 2020, 01:24:10 PM

Sigh.  I'm a slow learner.

I guess you shouldn't quote other people's posts unless you want what you took the time to write to become collateral damage. 

It sure makes following threads of conversation more difficult.

Post quarantining.  Great.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 08, 2020, 01:34:47 PM
Sigh.  I'm a slow learner.

I guess you shouldn't quote other people's posts unless you want what you took the time to write to become collateral damage. 

It sure makes following threads of conversation more difficult.

Post quarantining.  Great.

More like A Post Remedy.

HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 08, 2020, 01:59:16 PM
I think those measures certainly beat none. I keep daydreaming about a 3 ft by 3 ft UV sanitation grocery receiver box. Granted, that becomes a measure for 'who can afford it' if deemed effective.

(https://cdn.shopify.com/s/files/1/0317/8843/3544/products/Portable_LED_UV_Disinfection_Bag_6_df67b08b-0e44-479a-998f-d8d41cccfa7d_750x.jpg?v=1585067539)

https://bulepods.com/products/uv-light-sterilizer-box?variant=33086193533064&utm_medium=cpc&utm_source=google&utm_campaign=Google%20Shopping&gclid=EAIaIQobChMIu4Plqr3Z6AIVzP_jBx3f5wSBEAQYCSABEgIPQ_D_BwE (https://bulepods.com/products/uv-light-sterilizer-box?variant=33086193533064&utm_medium=cpc&utm_source=google&utm_campaign=Google%20Shopping&gclid=EAIaIQobChMIu4Plqr3Z6AIVzP_jBx3f5wSBEAQYCSABEgIPQ_D_BwE)
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 08, 2020, 02:10:54 PM
Did you just quote me directly???

Please allow at least one posts distance before replying.

(Wipes keyboard.)
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Meatwad on April 08, 2020, 03:09:53 PM
Should be 6 post distances
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 08, 2020, 03:17:06 PM
Should be 6 post distances

Some say at least 27. :)
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 08, 2020, 03:23:54 PM
[Edit: Crap!  I quoted him.]


Yes.  But I only waited one post to reply to him so I'm changing the rules. 

:noid
Title: Re: Covid 19 Prevention discussion ONLY
Post by: guncrasher on April 08, 2020, 03:49:39 PM
well I'm going out, haven't been to a grocery store in days. have a long list, but it's just food for 1 week.

will let you know how it is.


semp
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 08, 2020, 04:17:34 PM
Those who are asymptomatic (no symptoms of sickness) can be infected & still spread.

https://twitter.com/charlyne_yi/status/1247936107045703683?s=20
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 08, 2020, 04:25:23 PM
"Proper rest and protect your lungs: doctors on what you should really do for your health right now:"

https://www.theguardian.com/lifeandstyle/2020/apr/08/from-vitamin-c-to-breathing-exercises-doctors-on-what-you-should-really-do-for-your-health-right-now
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 08, 2020, 06:15:44 PM
In Bill Cosby's voice
would you stop touching me.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 08, 2020, 06:31:49 PM
This is sort of interesting.  Looks as if the toilet paper shortage may NOT be going away.   :O

https://www.msnbc.com/all-in/watch/the-truth-about-the-toilet-paper-shortage-81759813784
Title: Re: Covid 19 Prevention discussion ONLY
Post by: guncrasher on April 08, 2020, 07:23:29 PM
This is sort of interesting.  Looks as if the toilet paper shortage may NOT be going away.   :O

https://www.msnbc.com/all-in/watch/the-truth-about-the-toilet-paper-shortage-81759813784

that is true, found everything on my grocery list, except for paper towels and tp. tp is like at the bottom of the list.


semp
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 09, 2020, 03:50:29 AM
I stopped by and picked up paper towels and toilet paper for employees the last two days in a row. Our stores have had paper for a while..... just not filled up.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 09, 2020, 07:15:26 AM
If half of the sterilization methods described here are required to keep this thing at bay then we are toast

Bleach milk for how long? Yeah  right...

There is not half the ppl in the US that will take half the extreme measures listed here

That crap works maybe in Asia as they are mainly only Asians and are on average slightly more educated and disciplined than the average American

Not to mention places like NK and China where you just disappear if you don't abide by the rules set out by your commie gov

America is very different in so many ways  - not all of them good in times like this

<S>

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: icepac on April 09, 2020, 09:37:17 AM

Just like in the main arena, most can't spell "hoard".
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 09, 2020, 09:57:02 AM
4th day that numbers have not breached the last high (Apr 4).  I think we are seeing evidence that the quarantine is working.  These numbers look like they are topping out.
Reduction in Deaths, sadly, will lag.  There is a lot of sick people already in the pipeline. 

But the first step it to stop digging the hole you are trying to get out of.

(https://www.dropbox.com/s/fa39u8nb82iabfj/new_cases.png?raw=1)

And this is even while our testing continues to ramp up so it is probably even better than it looks.

Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 09, 2020, 10:54:39 AM

And this is even while our testing continues to ramp up so it is probably even better than it looks.

Federal testing sites and any federal funding for testing will stop on Friday.

https://www.npr.org/sections/coronavirus-live-updates/2020/04/08/829955099/federal-support-for-coronavirus-testing-sites-end-as-peak-nears

It would be reasonable see a drop in the number of new reported daily cases from this weekend forward.


To me this means that I will have to judge the level of the threat based on other sources.  (And I am the first to say that I am not sure what that means yet.)
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 09, 2020, 11:32:38 AM
Federal testing sites and any federal funding for testing will stop on Friday.

https://www.npr.org/sections/coronavirus-live-updates/2020/04/08/829955099/federal-support-for-coronavirus-testing-sites-end-as-peak-nears

It would be reasonable see a drop in the number of new reported daily cases from this weekend forward.


To me this means that I will have to judge the level of the threat based on other sources.  (And I am the first to say that I am not sure what that means yet.)


Not really.  The CBTS were only intended to be a temporary stop gap measure and now testing is transitioning to state level management.  Nobody is reducing testing.  They are just changing who is running it.

Quote
A spokesperson for the U.S. Department of Health and Human Services tells NPR, "Many of the Community-Based Testing Sites (CBTS) are not closing, but rather transitioning to state-managed sites on or about April 10."

The agency and a spokesperson for FEMA say the CBTS program originally included 41 sites. It was intended as a stop-gap to bring testing to critical locations, especially for health care facility workers and first responders.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 09, 2020, 11:38:45 AM
A stat I would like to see is what percentage of people put on  a ventilator recover?

HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Copprhed on April 09, 2020, 11:42:49 AM
A stat I would like to see is what percentage of people put on  a ventilator recover?

HiTech
It has been said that the number is lower the longer a ventilator is used.
https://www.usatoday.com/story/news/health/2020/04/08/coronavirus-cases-ventilators-covid-19/2950167001/
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 09, 2020, 01:36:58 PM
It also sounds like it is lower if you are African American or obese or if you smoke  or if.....

The lack of details is getting old...

<S>

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: 100Coogn on April 09, 2020, 02:31:43 PM
A stat I would like to see is what percentage of people put on  a ventilator recover?

HiTech

Was watching NBC the other night and Dr. Anthony Fauci said only about 20% of people on ventilators recover.

Coogan
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 10, 2020, 06:31:17 AM

Not really.  The CBTS were only intended to be a temporary stop gap measure and now testing is transitioning to state level management.  Nobody is reducing testing.  They are just changing who is running it.

I was glad to see this today:

"In Reversal, Federal Support For Coronavirus Testing Sites Continues"

https://www.npr.org/sections/coronavirus-live-updates/2020/04/09/830805038/in-reversal-federal-support-for-coronavirus-testing-sites-continues
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Puma44 on April 10, 2020, 09:38:16 AM
Was watching NBC the other night and Dr. Anthony Fauci said only about 20% of people on ventilators recover.

Coogan

Curious as to what percentage of COVID patients require ventilators.  Of those who do, how many have underlying medical conditions.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: NatCigg on April 10, 2020, 10:04:08 AM
reports i read are 20% need hospital. of that half need oxygen, half of that need the tube.  so the answer is around 5%.  and around 80% of that 5% die. so that puts the death rate around 4%.

Title: Re: Covid 19 Prevention discussion ONLY
Post by: NatCigg on April 10, 2020, 10:08:01 AM
reports today are 90% hospitalized had co morbidity. 50 hypertension, 50 obesity, 40 chronic lung disease, 30 diabetes, 30 cardiovascular disease.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Maverick on April 10, 2020, 10:25:39 AM
Just plain old extensive use of a ventilator in a non covid case raises a significant risk of pneumonia. Add that to the covid and it's going to be a tough situation.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: NatCigg on April 10, 2020, 10:54:17 AM
https://www.statnews.com/2020/04/08/doctors-say-ventilators-overused-for-covid-19/

interesting article.  doctors questioning common practice. notice strange behavior, near death blood oxygen levels yet the body is not responding that way.  doctors say patients look like altitude sickness, lungs function closer to normal than typical ards.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: puller on April 10, 2020, 11:17:33 AM
<S> natcigg...good to see you brother...hope all has been well :rock
Title: Re: Covid 19 Prevention discussion ONLY
Post by: guncrasher on April 10, 2020, 11:40:34 AM
been thinking about this all night.

several have asked basically the same question or statement. how many have underlying conditions, as if to say corona didn't kill them, other conditions did.

did you guys know that aids doesn't kill people? that's a true statement.

anyway, I'm fat, have asthma occasionally,  borderline diabetic, among other things.  so if i get the virus, my chances of having a memorial flight greatly increase.

so you can say well he had underlying conditions and it's true. but even with those underlying conditions I'm still in good shape. so no, those underlying conditions aren't gonna kill me in a few days, it may take years, add Corona virus and it goes down ti hours. so the virus killed me.


semp
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TheBug on April 10, 2020, 04:28:23 PM
been thinking about this all night.

several have asked basically the same question or statement. how many have underlying conditions, as if to say corona didn't kill them, other conditions did.

did you guys know that aids doesn't kill people? that's a true statement.

anyway, I'm fat, have asthma occasionally,  borderline diabetic, among other things.  so if i get the virus, my chances of having a memorial flight greatly increase.

so you can say well he had underlying conditions and it's true. but even with those underlying conditions I'm still in good shape. so no, those underlying conditions aren't gonna kill me in a few days, it may take years, add Corona virus and it goes down ti hours. so the virus killed me.


semp

Good time to start rectifying those underlying conditions.  As every patriot should.   :salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: snugar109 on April 10, 2020, 05:10:11 PM
Good time to start rectifying those underlying conditions.  As every patriot should.   :salute

Now is fat an underlying condition or is it food storage for hard times that might arrise? All perspective on that one lol
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 10, 2020, 05:15:57 PM
Now is fat an underlying condition or is it food storage for hard times that might arrise? All perspective on that one lol

I just watched this last night.  Some interesting info if you have the time. 

https://www.pbs.org/wgbh/nova/video/the-truth-about-fat/ (https://www.pbs.org/wgbh/nova/video/the-truth-about-fat/)

The answer is probably both.  In a brutal and hostile world, it was one of our most ingenious adaptations.  However, it was never designed to function in the insanely resource rich environment we 1st worlders live in today while being bombarded by High-Fructose-Corn Syrup Franken-Food products.  They put that crap in everything nowadays.

 :salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 11, 2020, 05:44:31 AM
A 3D model of a person coughing in an indoor environment – how an aerosol cloud travels in the air

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 11, 2020, 05:53:19 AM
Now is fat an underlying condition or is it food storage for hard times that might arrise? All perspective on that one lol

Your dice, you throw them. It is considered unhealthy and causes other health issues.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: NatCigg on April 11, 2020, 05:57:29 AM
using a mask makes some sense, sure would make that 6 feet thing a little more functional.  pretty obvious the world does not have the supplies to do this now. stay calm and just sit there, please.

One thing about co morbidity stats. if 50% of hospital admissions were obese, then 50% were NOT obese. 70% did not have diabetes, 50% did not have hypertension.

Of course its to early to draw any conclusions.  Seems to me, the biggest underlying factor is how will your immune system react to the virus.  if it reacts to cause severe organ stress, co-morbids could have a hard(er) time through the stress.  another big unknown is where else the virus affects the body.  going to take some time to figure it out.  in the mean time, does anyone want to take this placebo?  we are not letting anyone have any medicine until someone steps up and takes this placebo.!  :uhoh
Title: Re: Covid 19 Prevention discussion ONLY
Post by: NatCigg on April 11, 2020, 06:01:51 AM
<S> natcigg...good to see you brother...hope all has been well :rock

<S> Buddy.  alive, well, and doing the best i want to.  Hope you and yours are kicking butt!  :salute :salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 12, 2020, 02:16:09 PM

Looks to me like quarantine bends the curve.

(https://www.dropbox.com/s/nej0bc6gq01chpb/us-dialyflat.png?raw=1)
(https://www.dropbox.com/s/twys39oew6sx63f/us-deathsflat.png?raw=1)


It's certainly expensive, but at least we know we have a lever that can alter the trajectory.  That's better than being completely helpless.

Again, IMHO, these are the criteria we need to achieve to responsibly relax quarantine:

1.  Bend the Curve.  Get control of the spread.  Push it down below our medical systems saturation point. This also includes increasing out medical capability as well.  Complete setup of emergency overlflow facilities in hotels, dorms, convention centers.
2.  Get our testing system unscrewed.  Given our super-power status, our performance so far has been...embarrassing.
3.  PPE.  Medical system needs to have what it needs.  But also, workers you expect to come back need protective gear just like any other OSHA requirement of hardhats, eye protection, etc.
4.  Therapeutics.  A vaccine is a long ways off.  In the meantime, We need some effective treatments that can help other than aspirin for the sick and sedatives for the dying.


#1: We've made good progress.  I don't know if we need to push it down more to get below capacity, but I feel we proven at least one strategy that can bend the curve.
#2: We've made some progress. Apparently there are still swab shortages, reagent shortages, and overload in getting test processed.  But we are slowly getting there. 
#3: Still a big problem.  Not only should our medical system hero's have all they need, but I ought be be able to grab a pack of masks and nitrile gloves at any grocery store.
#4. Some promising green shoots here.  Nothing proven. A lot of work being done along various lines of inquiry.  We're not there yet, but I'm hopeful we will find something.

My guess is they won't have the will to accomplish all these before trying to lift quarantine. My guess is infections and deaths will begin to rise again.  Maybe not as steeply.  People have become a lot more paranoid.  Good.  But I think things will continue to climb and eventually until it gets sufficiently painful and  they will have to capitulate and go into some level of quarantine again.  Maybe in the Fall.

But at least for now, we've made some welcome progress.


Title: Re: Covid 19 Prevention discussion ONLY
Post by: Meatwad on April 12, 2020, 06:37:05 PM
I see a ton of people wearing masks, and not one of them appear sick. I think they are doing it just to make themselves believe they wont get it if they have a mask on
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 12, 2020, 06:46:27 PM
Good news and bad news.

https://reason.com/2020/04/09/preliminary-german-study-shows-a-covid-19-infection-fatality-rate-of-about-0-4-percent/ (https://reason.com/2020/04/09/preliminary-german-study-shows-a-covid-19-infection-fatality-rate-of-about-0-4-percent/)

Quote
Around 15 percent had been infected, allowing them to calculate a COVID-19 infection fatality rate of about 0.37 percent.

Quote
Basically, the German researchers found that the coronavirus kills about four times as many infected people than seasonal flu viruses do.

My thoughts on that would be:

a.  If our numbers are similar, it means we are no where close to Herd Immunity.  For this infection I've heard number between 70-85% to achieve effective Herd Immunity.
https://www.jhsph.edu/covid-19/articles/achieving-herd-immunity-with-covid19.html (https://www.jhsph.edu/covid-19/articles/achieving-herd-immunity-with-covid19.html)

b.  They didn't mention it is also 2-3x more infectious.   2-3x more infectious and 4x more lethal is still pretty concerning to me.

c.  I can think of at least 3 reasons our CFR number probably won't be as good as Germany's, but I don't want to take the chance of invoking Hitech's rules.

I'd consider Germany and S. Korea outcomes as the best possible outcomes if you do almost everything right.  I suspect our numbers are going to look a lot more like Italy before it's over.

 :salute



 


Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 12, 2020, 06:52:46 PM
I see a ton of people wearing masks, and not one of them appear sick. I think they are doing it just to make themselves believe they wont get it if they have a mask on

1.  Masks do provide some added protection from inhaling airborne particles and this virus has been proven to be able to stay suspended in the air (from coughing, sneezing, or just breathing) for up to an hour and be carried through ventilation systems.
 
2.  One of the biggest problems with this virus is that there seems to be a 2-5 day asymptomatic period where you are infected and infectious before you even run a temperature or feel the symptoms.  By the time you start feeling sick (or looking sick), you've probably already been walking around infecting everyone around you for a week without knowing it.

For both reasons, everyone should be wearing masks anytime they are out in public whether they think they are sick yet or not.  In fact, if they are feeling sick, don't even go out in public at all! 

 :salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 12, 2020, 07:48:53 PM

If you have a family member who sews it isn't hard to produce your own masks.  About mid-March it became obvious this was going to last a while and masks would be needed.    I ordered material and sent to my mom who sews and she downloaded some patterns off the internet and made some prototypes. 

She said the pleated ones were actually easier to make and easier to get a good fit on the face than the cup shaped.  All of these have an extra pocket for a sheet of paper towel or tissue as a disposable filter layer.  They say a sheet of that blue paper towel material like mechanics use has a filter almost as good as N95.  She also got fancy and sewed in a piece of florist wire across the nose bridge of each.  I wonder where I inherited my obsessive-compulsion from.  :rofl

She is going to send me those prototypes to try out and then we should have enough fabrics to get masks to our family members.  I'm suspecting the pleated tie strap version is going to be best.  I hear hospitals are preferring those for donated homemade masks as they are more durable and can fit a wider range of head sizes tightly.  More adjustable.

Get those sewing machines rolling. Homemade masks are the new Victory Garden.

:salute

(https://www.dropbox.com/s/adwnh62hx48974d/masks.jpg?raw=1)


Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 12, 2020, 09:39:39 PM
I like the reports that are coming out now in Texas. They break down how many are recovered, how many hospitalized, how many beds available, how many respirators and such.

While it is an issue in Texas, it is a small one still.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 12, 2020, 09:41:02 PM
If you have a family member who sews it isn't hard to produce your own masks.  About mid-March it became obvious this was going to last a while and masks would be needed.    I ordered material and sent to my mom who sews and she downloaded some patterns off the internet and made some prototypes. 

She said the pleated ones were actually easier to make and easier to get a good fit on the face than the cup shaped.  All of these have an extra pocket for a sheet of paper towel or tissue as a disposable filter layer.  They say a sheet of that blue paper towel material like mechanics use has a filter almost as good as N95.  She also got fancy and sewed in a piece of florist wire across the nose bridge of each.  I wonder where I inherited my obsessive-compulsion from.  :rofl

She is going to send me those prototypes to try out and then we should have enough fabrics to get masks to our family members.  I'm suspecting the pleated tie strap version is going to be best.  I hear hospitals are preferring those for donated homemade masks as they are more durable and can fit a wider range of head sizes tightly.  More adjustable.

Get those sewing machines rolling. Homemade masks are the new Victory Garden.

:salute

(https://www.dropbox.com/s/adwnh62hx48974d/masks.jpg?raw=1)

Some folks around here wearing bandanas.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: DREDIOCK on April 13, 2020, 12:24:06 AM
Good news and bad news.

https://reason.com/2020/04/09/preliminary-german-study-shows-a-covid-19-infection-fatality-rate-of-about-0-4-percent/ (https://reason.com/2020/04/09/preliminary-german-study-shows-a-covid-19-infection-fatality-rate-of-about-0-4-percent/)

My thoughts on that would be:

a.  If our numbers are similar, it means we are no where close to Herd Immunity.  For this infection I've heard number between 70-85% to achieve effective Herd Immunity.
https://www.jhsph.edu/covid-19/articles/achieving-herd-immunity-with-covid19.html (https://www.jhsph.edu/covid-19/articles/achieving-herd-immunity-with-covid19.html)

b.  They didn't mention it is also 2-3x more infectious.   2-3x more infectious and 4x more lethal is still pretty concerning to me.

c.  I can think of at least 3 reasons our CFR number probably won't be as good as Germany's, but I don't want to take the chance of invoking Hitech's rules.

I'd consider Germany and S. Korea outcomes as the best possible outcomes if you do almost everything right.  I suspect our numbers are going to look a lot more like Italy before it's over.

 :salute

I pointed at Germanys abnormal mortality rate here 3 weeks ago
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Maverick on April 13, 2020, 10:42:33 AM
My county (Kerr) is reporting 2 confirmed cases, no deaths as of last night.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 13, 2020, 10:46:31 AM
My county (Kerr) is reporting 2 confirmed cases, no deaths as of last night.

Ah, Kerrville. Best of luck to ya'll.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 13, 2020, 11:27:26 AM
My county (Kerr) is reporting 2 confirmed cases, no deaths as of last night.

Those in rural areas of course have the great advantage of low density.  On the other hand they tend to be an older demographic that is more susceptible. And if they are like my relatives out West Texas, they are probably hard to convince to take this threat seriously.  And sooner or later they have to go into a population center to get supplies.  I fear that it will get out there and spread through their Walmarts and churches and those areas have very sparse medical resources.

Something like 80% of the population of Texas is in it's major cities.  We've also been very slow with testing.  So it's easier to look good on the numbers if you don't test.  Texas is at the VERY bottom of the list for testing per 1mil population.  Dead last.   50th in testing.  15th in reported deaths, and I suspect that is materially under counted.   Don't Test Don't Tell.    Even Oklahoma has done a better job at testing than us. 

Ok-la-ho-ma... (face palm)

I'd like to hope we have some magical immunity, but I don't see why we would. DFW is a major air hub.  Houston a major shipping hub.  I think its probably a given that our numbers are under reported.

 
Title: Re: Covid 19 Prevention discussion ONLY
Post by: bustr on April 13, 2020, 03:09:38 PM
I kept searching for peer reviewed research papers on the SARS-CoV virus family. Back in the 2000's China was hit with SARS which had a devastating mortality rate. In 2011 out of the Lab in Wuhan they started a 5 year research project to find the source of the SARS-CoV virus. The Obama administration invested $3.7m to the study.

Between 2011 and 2015 in Yunnan they found a bat cave and about 11 versions of the SARS virus. They brought those back to Yuhan and replicated them and also created chimeric versions of them to test how those viruses infected human cells.

I was doing research on how the COVID-19 with some patients destroyed the heart, organs and lungs. It had to do with a protein receptor called Angiotensin-converting enzyme 2 (ACE2). This is the primary common vector into humans cells for COVID-19 and SARS-CoV. Oh..the word chimeric means they created a SARS virus for the experiment. Below is a paragraph from the research paper that may well be how we got COVID-19.

https://journals.plos.org/plospathogens/article?id=10.1371/journal.ppat.1006698

 Our previous studies demonstrated the capacity of both WIV1 and WIV16 to use ACE2 orthologs for cell entry and to efficiently replicate in human cells [17,18]. In this study, we confirmed the use of human ACE2 as receptor of two novel SARSr-CoVs by using chimeric viruses with the WIV1 backbone replaced with the S gene of the newly identified SARSr-CoVs. Rs7327’s S protein varied from that of WIV1 and WIV16 at three aa residues in the receptor-binding motif, including one contact residue (aa 484) with human ACE2. This difference did not seem to affect its entry and replication efficiency in human ACE2-expressing cells.

I have to think Dr. Fauci was aware of this study because he was with the NIH at the time of the research project and the NIH provided the $3.7m funding for the research. One might venture he talked the president into shutting the country down for 3 weeks to see if this virus was SARS-CoV which has up to a 30% mortality rate. Hmmmm, 2.2m dead estimate maybe, way back three weeks ago. Or COVID-19 which is a bad flu season. And to see if it would mutate into something worse because the study I included suggests the SARS family of viruses mutate easily.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: bustr on April 13, 2020, 03:21:02 PM
Here another clip from the research paper on how they created their own viruses for testing purposes of SARS-CoV.


Construction of recombinant viruses

Recombinant viruses with the S gene of the novel bat SARSr-CoVs and the backbone of the infectious clone of SARSr-CoV WIV1 were constructed using the reverse genetic system described previously [23] (S9 Fig). The fragments E and F were re-amplified with primer pairs (FE, 5’-AGGGCCCACCTGGCACTGGTAAGAGTCATTTTGC-3’, R-EsBsaI, 5’-ACTGGTCTCTTCGTTTAGTTATTAACTAAAATATCACTAGACACC-3’) and (F-FsBsaI, 5’-TGAGGTCTCCGAACTTATGGATTTGTTTATGAG-3’, RF, 5’-AGGTAGGCCTCTAGGGCAGCTAAC-3’), respectively. The products were named as fragment Es and Fs, which leave the spike gene coding region as an independent fragment. BsaI sites (5’-GGTCTCN|NNNN-3’) were introduced into the 3’ terminal of the Es fragment and the 5’ terminal of the Fs fragment, respectively. The spike sequence of Rs4231 was amplified with the primer pair (F-Rs4231-BsmBI, 5’-AGTCGTCTCAACGAACATGTTTATTTTCTTATTCTTTCTCACTCTCAC-3’ and R-Rs4231-BsmBI, 5’-TCACGTCTCAGTTCGTTTATGTGTAATGTAATTTGACACCCTTG-3’). The S gene sequence of Rs7327 was amplified with primer pair (F-Rs7327-BsaI, 5’-AGTGGTCTCAACGAACATGAAATTGTTAGTTTTAGTTTTTGCTAC-3’ and R-Rs7327-BsaI, 5’- TCAGGTCTCAGTTCGTTTATGTGTAATGT AATTTAACACCCTTG-3’). The fragment Es and Fs were both digested with BglI (NEB) and BsaI (NEB). The Rs4231 S gene was digested with BsmBI. The Rs7327 S gene was digested with BsaI. The other fragments and bacterial artificial chromosome (BAC) were prepared as described previously. Then the two prepared spike DNA fragments were separately inserted into BAC with Es, Fs and other fragments. The correct infectious BAC clones were screened. The chimeric viruses were rescued as described previously [23].
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 13, 2020, 04:48:33 PM
Texas is 30 plus million people. I feel confident anyone dieing it is known how they died. As for testing, it is moving along. I only know of one person who tried to be tested and he was told to go home and shelter. His wife had a bug for about 24 hours and then she was fine.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 13, 2020, 06:50:17 PM

An airborne version of AIDS?  Great.

Start at 8:55   Interesting but disturbing.  Covid-19 my be acting like AIDS.  Some evidence on why hydroxychloroquine my have effectiveness.  Possible long term damage even if you survive.  That argues against the lets just let everyone get it strategy. 


Title: Re: Covid 19 Prevention discussion ONLY
Post by: redcatcherb412 on April 13, 2020, 09:32:40 PM
If you have a family member who sews it isn't hard to produce your own masks.  About mid-March it became obvious this was going to last a while and masks would be needed.    I ordered material and sent to my mom who sews and she downloaded some patterns off the internet and made some prototypes. 

She said the pleated ones were actually easier to make and easier to get a good fit on the face than the cup shaped.  All of these have an extra pocket for a sheet of paper towel or tissue as a disposable filter layer.  They say a sheet of that blue paper towel material like mechanics use has a filter almost as good as N95.  She also got fancy and sewed in a piece of florist wire across the nose bridge of each.  I wonder where I inherited my obsessive-compulsion from.  :rofl

She is going to send me those prototypes to try out and then we should have enough fabrics to get masks to our family members.  I'm suspecting the pleated tie strap version is going to be best.  I hear hospitals are preferring those for donated homemade masks as they are more durable and can fit a wider range of head sizes tightly.  More adjustable.

Get those sewing machines rolling. Homemade masks are the new Victory Garden.

:salute

(https://www.dropbox.com/s/adwnh62hx48974d/masks.jpg?raw=1)
Mask studies, they cannot make up their minds what's best. 

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4420971/

From the above study summation
We have provided the first clinical efficacy data of cloth masks, which suggest HCWs should not use cloth masks as protection against respiratory infection. Cloth masks resulted in significantly higher rates of infection than medical masks, and also performed worse than the control arm. The controls were HCWs who observed standard practice, which involved mask use in the majority, albeit with lower compliance than in the intervention arms. The control HCWs also used medical masks more often than cloth masks. When we analysed all mask-wearers including controls, the higher risk of cloth masks was seen for laboratory-confirmed respiratory viral infection.

Laboratory tests showed the penetration of particles through the cloth masks to be very high (97%) compared with medical masks (44%) (used in trial) and 3M 9320 N95 (less than 0.01%), 3M Vflex 9105 N95 (0.1%).


So who is right CDC, NIH ? Time will tell, but if you think a mask is the catch all then by all means use them.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 13, 2020, 11:30:42 PM
So who is right CDC, NIH ? Time will tell, but if you think a mask is the catch all then by all means use them.

Your're confused and missing the point.

HCW (Health Care Workers)  Should have N-95 masks.   When there are all the N-95 mask the HCW need  and more available, everyone else should use them too.  In the meantime, for those that aren't HCW, a cloth mask offers better protection than breathing the virus directly down into your unprotected lungs.

But I would encourage you and your family not to use any masks at all if you and not comfortable.

;)



Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 14, 2020, 07:02:32 AM
Bustr

Your comments sound like the  virus was humanly manipulated which can also be called weaponized

<S>

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 14, 2020, 09:51:52 AM
Bustr

Your comments sound like the  virus was humanly manipulated which can also be called weaponized

<S>

Eagler

I saw nothing to suggest that. It's a genetic code.

But considering that polls suggest that 29% of us seem to want to believe that this was an attack, this post might be enlightening; all research from western immunologists.

https://www.sciencenews.org/article/coronavirus-covid-19-not-human-made-lab-genetic-analysis-nature

Title: Re: Covid 19 Prevention discussion ONLY
Post by: redcatcherb412 on April 14, 2020, 09:54:31 AM
Your're confused and missing the point.

HCW (Health Care Workers)  Should have N-95 masks.   When there are all the N-95 mask the HCW need  and more available, everyone else should use them too.  In the meantime, for those that aren't HCW, a cloth mask offers better protection than breathing the virus directly down into your unprotected lungs.

But I would encourage you and your family not to use any masks at all if you and not comfortable.

;)
You're a hoot trips, you post endless reams and reams of advice with links from all sorts of sources, post graphs endlessly sprinkled with your sage thoughts of the death to befall everyone, but one post of a scientific study that you don't agree with and your F-off attitude spills out. Like I said if folks feel better wearing a cloth mask for a 3% less chance of a hit, that's their choice and by all means use them.

Your childish response encouraging my family not to use anything is just that, childish. I'll keep your family out of it, but stooping down to your level, I will add, you should yourself personally use the 100% mask of saran wrap tightly wrapped around your face for no chance of any viral infiltration. :salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Maverick on April 14, 2020, 10:05:23 AM
Even though the relative age of folks in this area is shall we say, elevated, most are taking the threat seriously. The roads are virtually abandoned. It's like driving on Christmas morning / day because everyone is celebrating at home. Businesses are closed of course other than the essential ones. I hope the situation gets over fairly soon. I have a surgery I need to correct a painful trigger finger and my hair is now as long as it was when I was a teenager in HS. Far different color but it needs cutting.

Stores are getting stocked again and we were able to get everyth8ing we ordered this week. The wife kinda went crazy on buying groceries. Now we have to freeze a couple loaves of bread to keep them from going bad before I can use them.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 14, 2020, 10:15:24 AM

First, I don't think I questioned anything in the study you posted.  I questioned the conclusion you drew from it.

Second, let me get this straight...You claim that cloth masks don't work and possibly increase your risk, and then complain when I suggest you don't use one if you are not comfortable with them.

You are acting irrational.




Title: Re: Covid 19 Prevention discussion ONLY
Post by: TheBug on April 14, 2020, 10:16:28 AM
And so it begins again....
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 14, 2020, 10:27:56 AM
Even though the relative age of folks in this area is shall we say, elevated, most are taking the threat seriously. The roads are virtually abandoned. It's like driving on Christmas morning / day because everyone is celebrating at home. Businesses are closed of course other than the essential ones. I hope the situation gets over fairly soon. I have a surgery I need to correct a painful trigger finger and my hair is now as long as it was when I was a teenager in HS. Far different color but it needs cutting.

Stores are getting stocked again and we were able to get everyth8ing we ordered this week. The wife kinda went crazy on buying groceries. Now we have to freeze a couple loaves of bread to keep them from going bad before I can use them.

That's good to hear.  We had trouble convincing our relatives that it wasn't all a media hoax.  Couldn't get them to agree to stop going to their crowded church services.  Thankfully their pastor decided to make the call and go virtual.

Still can't convince my uncle to wear a mask when he goes to the store.  Trying to convince him it is not about him being a tough guy, but him getting infected and then bringing that back to his wife, kids, and grandkids.

Like I tell a friend, this isn't like riding a motorcycle without a helmet. That is only your own melon you are putting at risk.  When you are dealing with an infectious disease, the irresponsible stuff you do put other peoples safety at risk without their consent.  And that in my opinion is immoral.

:salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 14, 2020, 12:12:35 PM
https://medium.com/@yinonweiss/lets-visualize-state-by-state-shutdown-effectiveness-on-covid-19-e13a5cdb50ad


At last an attempt at some real analysis.

Anyone else  notice the following attitude in the media?
Quote
We cant do anything until we have clinical proof of a method/drugs effectiveness.

Please show me study of the effectiveness of the stay at home orders, business closing vs other less intrusive methods.

We don't need to do that, it's common sense.  :rolleyes:

HiTech
 


Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 14, 2020, 12:56:29 PM
At last an attempt at some real analysis.

It's a reasonable attempt.

His model is pretty dependent on a very large bonus for warm weather given the data that has been emerging.  It's not entirely clear yet that is going to help:
https://www.forbes.com/sites/daviddisalvo/2020/04/13/why-we-cant-trust-warm-weather-to-stop-coronavirus/#350842d62143 (https://www.forbes.com/sites/daviddisalvo/2020/04/13/why-we-cant-trust-warm-weather-to-stop-coronavirus/#350842d62143)

And the advantage of more rural states may not be what he thinks it is in the long run.  People still go to the closest Walmart for shopping.  On a weekend, the Walmart out by my land is just as crowded as any in DFW.  Rural people come from miles around to do their shopping.  Then on Sunday they all pile in to the local Baptist church to sit shoulder to shoulder and expel lots of breath singing hymns for 2 hours.

Or hang out with the ranching buddies at the local Dairy Queen for hours.

Their houses may be sparsely distributed, but humans are gregarious monkeys and tend to invent reasons to cluster often.

But it's certainly a reasonable discussion to have.  Some version of this will certainly be useful for the Governors to consider as they decide when to best lift quarantines in their individual states.

:salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 14, 2020, 01:29:36 PM
It's a reasonable attempt.

His model is pretty dependent on a very large bonus for warm weather given the data that has been emerging.  It's not entirely clear yet that is going to help:
https://www.forbes.com/sites/daviddisalvo/2020/04/13/why-we-cant-trust-warm-weather-to-stop-coronavirus/#350842d62143 (https://www.forbes.com/sites/daviddisalvo/2020/04/13/why-we-cant-trust-warm-weather-to-stop-coronavirus/#350842d62143)

And the advantage of more rural states may not be what he thinks it is in the long run.  People still go to the closest Walmart for shopping.  On a weekend, the Walmart out by my land is just as crowded as any in DFW.  Rural people come from miles around to do their shopping.  Then on Sunday they all pile in to the local Baptist church to sit shoulder to shoulder and expel lots of breath singing hymns for 2 hours.

Or hang out with the ranching buddies at the local Dairy Queen for hours.

Their houses may be sparsely distributed, but humans are gregarious monkeys and tend to invent reasons to cluster often.

But it's certainly a reasonable discussion to have.  Some version of this will certainly be useful for the Governors to consider as they decide when to best lift quarantines in their individual states.

:salute

The bigger advantage of rural I believe  is not density but that outsider do not mix into the population as much. I.E. DFW airport people who work their interact with many people who then interact with the area population.

Another may be the simple knowledge the residence have of who is who.

I grew up in rural Iowa btw.

HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 14, 2020, 01:36:29 PM
The bigger advantage of rural I believe  is not density but that outsider do not mix into the population as much. I.E. DFW airport people who work their interact with many people who then interact with the area population.

Another may be the simple knowledge the residence have of who is who.

I grew up in rural Iowa btw.

HiTech

There are certainly a lot less strangers out there.  I don't even know who is in the apartment next to me.  Not sure I've ever even seen them in 8 years.  :rofl  But I know neighbors in a 5 mile radius of my property.  ;)

On the on the other hand, a lot of my neighbors out there are long-haul truckers.  Criss-crossing the country all week long.  :noid  One even works at Lockheed making the hour commute each way.   :O 




Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 14, 2020, 01:51:13 PM
I don't even know who is in the apartment next to me. 

One day around 2003 I met a fair looking, at my local bar in Grapevine. We started talking and eventually I asked what part of town she lived in. She said the apartments off of Park Blvd, Oh said I, I also live there.  After multple narrow downs I find out we share a common bedroom wall (apartments are mirrored). And then even more strange was that we both had lived there more then 5 years and In all that time I never saw her coming or going.

HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 14, 2020, 01:56:31 PM
One day around 2003 I met a fair looking, at my local bar in Grapevine. We started talking and eventually I asked what part of town she lived in. She said the apartments off of Park Blvd, Oh said I, I also live there.  After multple narrow downs I find out we share a common bedroom wall (apartments are mirrored). And then even more strange was that we both had lived there more then 5 years and In all that time I never saw her coming or going.

Probably due to no window in that wall.  :D
Title: Re: Covid 19 Prevention discussion ONLY
Post by: bustr on April 14, 2020, 02:35:16 PM
Bustr

Your comments sound like the  virus was humanly manipulated which can also be called weaponized

<S>

Eagler

In 2017 when the article was finally published, took 2 years to put together all of the test results in a paper after the testing stopped in 2015. The Chinese government was concerned with SARS-CoV outbreaks that have a 30% mortality rate. And they were very proud of their science sector and accomplishments. Allowing the recombination formula to be shown to the world was them showing how advanced China was in that science and SARS-CoV research. Recombining the more lethal 11 strains they found in the bat cave into chimeric versions allowed them a level of safety to more easily observe the ACE2 path the virus used to infect cells. AIDS\HIV uses the same vector and in 2005 Hydroxychloroquine\Chloroquine was tested and found to have salutary effects against HIV1. And in laboratory settings it was found to inhibit the ACE2 vector SARS-CoV used to infect human cells.

Honestly, I suspect a researcher screwed up and had a Lab boo boo and carried one of the less lethal chimera versions home with him. The parent 11 SARS-CoV found in the bat cave are not novel. COVID-19 is considered novel because it has never been seen before. But, by looking at it's DNA finger print it was traced to the horse shoe bats carrying the original 11 SARS-CoV variations in China. And how would anyone know about those horse shoe bats? The 2017 peer reviewed paper I linked becasue it's all there in scientific blue print form. If the CCP wanted to spread a virus they would have created a chimeric MERS virus and let the blame fall on the middle east since they have many military and diplomatic missions in that region. MERS has the same 30% mortality rate and is in the SARS family. But, it would have been easier to shut off the middle east than the Chinese who have direct flights now into the EU, Middle East, Asia and the USA. And with those direct flights, Chinese would carry it home to China and everywhere else leaving the Middle East to hold the bag so to say.

They had a Lab boo boo and won't admit it to save face.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: mora on April 14, 2020, 02:41:45 PM
The New York numbers are just awful. At 552 deaths per million they are miles ahead of Spain and Belgium at 386 and 359 respectively. Calculating with a CFR of 0,5 %, the number of infected people would be two million or 10 % of the population. Infact more, as not all who are going to die have died yet. Is there a herd immunity in some communities by now? If yes, then there should be a drastic drop soonish.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 14, 2020, 02:50:03 PM
Infact more, as not all who are going to die have died yet.

I doubt it.

Is there a herd immunity in some communities by now? If yes, then there should be a drastic drop soonish.

The numbers are dropping from quarantine, but I doubt we are anywhere close to herd immunity.  For the R0 I've seen estimates of 70-85% infection distribution required.

We can prove we are not at herd immunity it two ways.

1.  Get antibody tests out and determine if there is evidence 70% of people have already had it.

2.  Prematurely lift quarantine and send everyone back out and watch what happens.  If we are at herd immunity, infection rates shouldn't spike back up.

I recommend the former.   ;)

:salute






Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 14, 2020, 02:54:30 PM
Much more than a boo boo but it is about saving face

Not for letting it lose but against those that have been insulting their cultural ...stopped here to avoid slipping into politics...

Eagler

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 14, 2020, 02:55:27 PM
https://www.sciencealert.com/why-herd-immunity-will-not-save-us-from-the-covid-19-pandemic

 :salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 14, 2020, 03:01:53 PM
Honestly, I suspect a researcher screwed up and had a Lab boo boo and carried one of the less lethal chimera versions home with him.

If it came from that lab, which is not out of the realm of possibility, I would suspect that is bar far the likely answer.

I see nothing that that looks to me an intentional act.  It just would make any sense.  Their economy has taken a massive hit.  A failed economy have even more dire consequences for their leaders than it does for ours.  They don't want to look like a late Soviet economic failure.  Look what happened to them.

Never ascribe to evil plots what can simply be explain by good old fashion fkup.






Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 14, 2020, 03:17:38 PM
Never ascribe to evil plots what can simply be explain by good old fashion fkup.

My first marriage was a fkup on my part but I'm still fairly certain it was an evil plot on hers.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: mora on April 14, 2020, 03:26:19 PM
I was not talking about herd immunity in the correct sense, but taking into account the measures already in place. The Rt, the effective reproductive correlates to the percentage of immune people. If the R0 is already 1 the Rt would drop to 0.85 if 15 % are immune. The immunity already in place would help a lot in getting to <1. Would quaranteening areas inside a city help in fighting this, and would it even be politically possible? If yes, then acting now could save tens of thousands of lives. With no measures and unlimited medical resources, there would be about 70,000 deaths in NY before herd immunity. With the existing resources maybe 100,000.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 14, 2020, 03:57:55 PM
I was not talking about herd immunity in the correct sense, but taking into account the measures already in place. The Rt, the effective reproductive correlates to the percentage of immune people. If the R0 is already 1 the Rt would drop to 0.85 if 15 % are immune. The immunity already in place would help a lot in getting to <1. Would quaranteening areas inside a city help in fighting this, and would it even be politically possible?


Have you ever seen the videos of the Chinese police welding people's apartment door shut?  We could try that.   :noid

I'm not sure about the R numbers.  There seems to be different definitions. Quarantining helps.  But we've probably gotten near all the help out of it that we are going to.  It would get worse quickly if we try and lift I suspect.

We're making progress on therapeutics, but I don't know how large an effect we can have in the short term.

Even if we somehow maintained quarantine (which we won't), I'm afraid we still have a lot of deaths to come because of the number that are already sick and progressing toward an outcome.  For the last month I've been watching the US deaths vs Recovered.  That ratio has not improved.  We have 600k people already sick.  If the current ratio holds, you would expect a significant percentage of those 600k finally resolving into the fatality column.

Unless we really pull out a miracle on the treatment side in the next 3-4 weeks.  Anything is possible.  But they better hurry.

A vaccine of course is probably still a year off from actual deployment.

:salute

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 14, 2020, 04:15:09 PM
I have yet to ever hear of anyone immune to the flu.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: bustr on April 14, 2020, 05:35:29 PM
https://www.sciencealert.com/why-herd-immunity-will-not-save-us-from-the-covid-19-pandemic

 :salute

This gentleman did an opinion write in for science alert. Here is his back ground which I suspect he only has an opinion this early in his short Medical career.


Gideon Meyerowitz-Katz

Gideon Meyerowitz-Katz is an epidemiologist working in chronic disease in Sydney's west, with a particular focus on diabetes. He writes a weekly blog on public health, policy, and science communication-particularly where these things go wrong. He has recently begun a PhD with the University of Wollongong researching the social determinants of diabetes, and is passionate about the social causes of our ill health.
 
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 14, 2020, 05:39:04 PM
https://abcnews.go.com/Health/leaders-weigh-pursuit-herd-immunity-experts-warn-risks/story?id=70072952
Title: Re: Covid 19 Prevention discussion ONLY
Post by: bustr on April 14, 2020, 06:24:24 PM
Also for the biological weapon conspiracy theorists, most are following work by a Prof. Francis Boyle. I'm including part of a video where he asserts he found the bio weapon smoking gun. He has not ever referenced the 2017 paper I linked about the Wuhan 2011-2015 study of the origins of SARS-CoV carrying bats in China. And the NIH provided $3.7m for that study because the USA wanted info on SARS since it was so deadly. Boyle also didn't reference the 2005 SARS research about the efficacy of Chloroquine stopping SARS using the ACE2 vector to infect cells.

In the Chinese published 2011-2015 study the Chinese showed how they did genetic recombination to the SARS-CoV strains that they found in Yunne. What Prof. Boyle called weaponizing is standard practice to study virus and test them. Ft Detrick try's to have samples of every deadly disease possible for research purposes while the Lab in N.C. is Federally funded to do infectious disease study just like Berkeley hosts the federally funded Lawrence Berkeley National Laboratory for Physics and energy research.

By the way this professor has gotten himself banned from serious scientific communities in the USA and EU because of his conspiracy theories. I don't know if Hitech has blocked embedding or Youtube has blocked this guy's videos. Here is the link. 

https://www.youtube.com/watch?v=XaFRQN09x7M   
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TheBug on April 14, 2020, 06:33:01 PM
It has to be a man-made bio weapon.  What motive would nature have for wanting to kill us off, especially in highly densely, populated tributes to human triumph.   :headscratch:
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 14, 2020, 06:55:50 PM
I have yet to ever hear of anyone immune to the flu.

Not sure where you live but where I am they offer flu shots every autumn for the "flu strain of the year". The shots might not make everyone immune but they sure as hell keep the vast majority from getting sick.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 14, 2020, 07:04:04 PM
What motive would nature have for wanting to kill us off, especially in highly densely, populated tributes to human triumph.   :headscratch:

All weaponized by man?

https://www.livescience.com/worst-epidemics-and-pandemics-in-history.html (https://www.livescience.com/worst-epidemics-and-pandemics-in-history.html)

(https://media.tenor.com/images/a97ca5e5bbd710df1a4afa3045579969/tenor.gif)
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TheBug on April 14, 2020, 08:42:51 PM
Must of missed the sarcasm.  Glad I gave you a project to do though.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 14, 2020, 08:54:09 PM
Must of missed the sarcasm.  Glad I gave you a project to do though.

Gave it to myself. But if you wanna feel important .... ;)
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TheBug on April 14, 2020, 09:12:14 PM
Gave it to myself.

I'm sure you do..
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 14, 2020, 09:22:01 PM
If it came from that lab, which is not out of the realm of possibility, I would suspect that is by far the likely answer.

I see nothing that that looks to me an intentional act.  It just would make any sense.  Their economy has taken a massive hit.  A failed economy have even more dire consequences for their leaders than it does for ours.  They don't want to look like a late Soviet economic failure.  Look what happened to them.

Never ascribe to evil plots what can simply be explain by good old fashion fkup.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 15, 2020, 07:48:27 AM
Sounds like plasma from cured patients might be the best bet for immediate treatment

That said should we require a donation from the cured victims before they are released?

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 15, 2020, 07:52:54 AM
Edit
Title: Re: Covid 19 Prevention discussion ONLY
Post by: turt21 on April 15, 2020, 07:57:51 AM
https://www.youtube.com/watch?time_continue=224&v=I3xpRZITi2w&feature=emb_logo
Title: Re: Covid 19 Prevention discussion ONLY
Post by: NatCigg on April 15, 2020, 08:06:41 AM
Sounds like plasma from cured patients might be the best bet for immediate treatment

That said should we require a donation from the cured victims before they are released?

Eagler

 :noid :noid :noid :noid :noid :noid :noid :noid :noid :noid :noid :noid :noid :noid :noid :noid
i don't think we should make anything like that mandatory.  :old:
there is a pretty big incentive already in place, saving lives.  if thats not enough. a 500$ check would do it.  :bolt:
Title: Re: Covid 19 Prevention discussion ONLY
Post by: NatCigg on April 15, 2020, 08:19:54 AM
I like california plan, at least as a start for discussion if nothing else.

This virus aint going anywhere.  We need a plan going forward, i dont want any chaos in the streets!

Hopefully the 6 steps will actually be feasible in the next 3 weeks, ahem 2 weeks.


Title: Re: Covid 19 Prevention discussion ONLY
Post by: bustr on April 15, 2020, 02:06:39 PM
R 4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TheBug on April 15, 2020, 02:14:09 PM
Nice job Bustr.  Well at least the number of pages were more than doubled on this thread.  Some people seem to be learning at least.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: bustr on April 15, 2020, 03:22:37 PM
R 4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: bustr on April 15, 2020, 06:53:59 PM
R 4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 16, 2020, 06:40:27 AM
County has a 9pm curfew now

I was thinking when someone will publish a how to book about self quarantining and social distancing.

It could be an attempt at a serious instructional manual type or light hearted comedy poking at the ridiculous side - either way I think it would sell well

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: NatCigg on April 16, 2020, 07:44:25 AM
sounds like a good idea.  my, and probably some other with a greater understanding, believe we are in this for a long time, forever in fact.

the drug trials and drug availability looks like around fall, before mass distribution, and that is if anything even works.

The hope it will all just go away is looking more like a waste of time.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 16, 2020, 12:36:19 PM

The ‘Everyone’s Got It’ Theory
https://www.nationalreview.com/2020/04/coronavirus-testing-undercounting-covid-19-cases-likely/ (https://www.nationalreview.com/2020/04/coronavirus-testing-undercounting-covid-19-cases-likely/)

When the history of this is finally written, I suspect the US' performance up to this point is going to be a real national embarrassment.  We didn't handle beginning phase of this competently.  I'm not saying we are the only clown show, but I expected better from the world's only super-power.  Our lack of performance is going to cost tens of thousands of unnecessary deaths.
https://www.cnn.com/2020/04/16/world/coronavirus-response-lessons-learned-intl/index.html (https://www.cnn.com/2020/04/16/world/coronavirus-response-lessons-learned-intl/index.html)

Let's see if we can redeem ourselves in the second half...

Also, a very cogent analysis of lockdown.  I couldn't have agreed more, which given the author is kinda shocking. 
https://www.politico.com/news/magazine/2020/04/15/the-absurd-case-against-the-coronavirus-lockdown-189265 (https://www.politico.com/news/magazine/2020/04/15/the-absurd-case-against-the-coronavirus-lockdown-189265)


Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 16, 2020, 01:15:48 PM
Also, a very cogent analysis of lockdown.  I couldn't have agreed more, which given the author is kinda shocking. 
https://www.politico.com/news/magazine/2020/04/15/the-absurd-case-against-the-coronavirus-lockdown-189265 (https://www.politico.com/news/magazine/2020/04/15/the-absurd-case-against-the-coronavirus-lockdown-189265)

I'm still looking for the analysis , I see big straw man (compare to flu). Comparing to flu is not an argument in any way of what we should do, but it is good for a sense of scale.

Then an opinion with no proof.
Quote
If we are going to have 60,000 deaths with people not leaving their homes for more than a month, the number of deaths obviously would have been higher—much higher

Followed by more arguments based on his unproven and non quantified assumption with out any analysis of what the net treasure and blood are going to be from the shutdowns .


HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 16, 2020, 01:19:34 PM
Also some idea of how food stores are affected.

https://theconservativetreehouse.com/2020/04/15/ag-secretary-sonny-perdue-discusses-challenges-shifting-food-supply-chains/

HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: FLS on April 16, 2020, 01:45:59 PM
The point of the lock down was to prevent overwhelming the medical response.

The number of cases is lower than predicted, even NYC is managing, it's time to reopen.

People at risk should still be careful.

People should wear masks where needed until they are tested and know they aren't contagious.

Of course people should wear masks every flu season and not go to work when sick. Maybe we'll see some changes there.

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 16, 2020, 01:52:42 PM
(https://i.imgur.com/MWsiZbn.png)
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Mister Fork on April 16, 2020, 02:29:57 PM
(https://i.imgur.com/MWsiZbn.png)

+1 on that. You can only take off the parachute if you can land safely from the height you are at. And that means maybe a couple feet from the ground. And, AND, it all has to be done by all others in parachutes at the exact same time.

HOWEVER, if someone releases too soon, we have to put everyone up in the air, and jump again with parachutes on exactly for the same height and distance, back down again to the safe height.... Otherwise, it becomes groundhog day.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: FLS on April 16, 2020, 02:37:27 PM
Except you're landing on a barge, and it's moving away from you, and if you wait too long you'll miss it and drown.

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 16, 2020, 02:40:06 PM
Except you're landing on a barge, and it's moving away from you, and if you wait too long you'll miss it and drown.

Releasing 500 ft. over the barge may keep you from drowning but .....
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 16, 2020, 02:58:26 PM
See rule 4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 16, 2020, 03:42:53 PM
(https://i.imgur.com/MWsiZbn.png)

False analogy. It is not a binary choice of what to do. More like do I turn left,right, increase decent rate or slow decent rate to miss that tree. Because if I continue to take the current path that tree is going to mess me up, and possible kill me.

HiTech

Title: Re: Covid 19 Prevention discussion ONLY
Post by: icepac on April 16, 2020, 03:48:02 PM
See rule #4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: FLS on April 16, 2020, 03:50:59 PM
Releasing 500 ft. over the barge may keep you from drowning but .....

So broken leg, broken ankle, twisted ankle....or death,  when to release?  Now it's a better analogy.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: redcatcherb412 on April 16, 2020, 04:22:41 PM
The point of the lock down was to prevent overwhelming the medical response.

The number of cases is lower than predicted, even NYC is managing, it's time to reopen.

People at risk should still be careful.

People should wear masks where needed until they are tested and know they aren't contagious.

Of course people should wear masks every flu season and not go to work when sick. Maybe we'll see some changes there.
Meanwhile my county in NW New Mexico considered a hotspot because of the Navajo Tribes virus counts has the only hospital for the county announcing layoffs because there's no work with the lockdown and not able to do anything but emergency surgeries.

There is one other large hospital on the reservation within the county, but only for the natives that stands virtually empty as 45% of the county's positive virus cases are from the tribe and using the only in county off reservation hospital for testing and treatment.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 16, 2020, 04:37:00 PM
I'm still looking for the analysis , I see big straw man (compare to flu).

The problem is, how to you prove an averted disaster?

So I go driving with a friend but insist he wear a seat-belt.  We get into a head-on but we survive.  The seat-belt strap left a painful bruise on his collar bone.  "See," he says, "I shouldn't have worn that seat-belt!  Look at this bruise!  I should have just put my hand out and stopped my head from hitting the windshield!"

How do I prove to him the bruise was worth saving his life?  You can tell him what would have been the alternative and he will say "That's opinion, not proof!"

So you go get a rental car and take him for another ride and tell him not the wear the seat-belt.  You get up good speed and swerve into a wall. He puts hand out and it snaps at the elbow and his head is shredded through windshield broken glass and his brains are on the hood. Well, now we know.  Q.E.D.

Thank goodness I opted for the rental insurance.  ;)


Then an opinion with no proof.

Well, uhhh,  it was in the Opinion section and was a response to a previous Opinion article in the Opinion section so.....


Title: Re: Covid 19 Prevention discussion ONLY
Post by: FLS on April 16, 2020, 04:44:49 PM
See rule #4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 16, 2020, 04:46:51 PM
See rule #4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 16, 2020, 04:47:14 PM
The problem is, how to you prove an averted disaster?

So I go driving with a friend but insist he wear a seat-belt.  We get into a head-on but we survive.  The seat-belt strap left a painful bruise on his collar bone.  "See," he says, "I shouldn't have worn that seat-belt!  Look at this bruise!  I should have just put my hand out and stopped my head from hitting the windshield!"

How do I prove to him the bruise was worth saving his life?  You can tell him what would have been the alternative and he will say "That's opinion, not proof!"

Well, uhhh,  it was in the Opinion section and was a response to a previous Opinion article in the Opinion section so.....

Simple you show him video of crash test dummy's and the g load data. Then it is no longer opinion/conjecture. Up until then it is.

The point is you look at data with and with out the item you are trying to test, like South Dakota and Sweden.

What you don't do is blindly assume that confining people to their house , is better then other forms of prevention.

HiTech

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 16, 2020, 04:47:56 PM
See rule #4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 16, 2020, 04:57:34 PM
Simple you show him video of crash test dummy's and the g load data. Then it is no longer opinion/conjecture. Up until then it is.

He would say, "Well, that's different!  My arms are stronger than a test dummy.  Apples and oranges."  Basically you can't prove to someone who has made their mind up a hypothetical after the event. 

What you don't do is blindly assume that confining people to their house , is better then other forms of prevention.

You mean other than 200 years of epidemiology?

Why do you think they quarantined tuberculous patients before they had a vaccine?  Do you think the illness would not have spread if they just let them wander New York and Chicago?

The real issue is we were way behind the curve. We might not have had to quarantine as hard if we had acted earlier and tested more aggressively to isolate the initial clusters.  But we flubbed it on so many levels.  On an exponential curve the best leverage you have are in the initial days.  After you let it pick up steam, it takes much more dramatic efforts to bend the curve later.

Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 16, 2020, 06:22:46 PM
False analogy. It is not a binary choice of what to do. More like do I turn left,right, increase decent rate or slow decent rate to miss that tree. Because if I continue to take the current path that tree is going to mess me up, and possible kill me.

HiTech

Note to Self: don't hire HiTech as your Jumpmaster
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 16, 2020, 06:24:37 PM
When has are entire population been quarantined with the people who aren't sick versus the people who are not sick.

In fact here your quarantine sick people with non sick people.

I cannot prove if the isolation is working or not working but nor can you I would like to see your evidence that it is.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 16, 2020, 06:40:15 PM
Note to Self: don't hire HiTech as your Jumpmaster

I would never want to jump out a perfectly good airplane.

HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 16, 2020, 07:17:11 PM
I cannot prove if the isolation is working or not working but nor can you I would like to see your evidence that it is.

You don't think the flattening of the new US cases curve looks like quarantine has had an effect?




I have read several articles recently studying approaches to past pandemics to try and draw lessons. 

In particular looking at different US cities during the 1918 Influenza.  Consistently cities that acted quickly and decisively fared better:

Quote
Economists Sergio Correia, Stephan Luck, and Emil Verner released a working paper (not yet peer-reviewed) last week that makes this argument extremely persuasively. The three analyzed the 1918-1919 flu pandemic in the United States, as the closest (though still not identical) analogue to the current crisis. They compare cities in 1918-’19 that adopted quarantining and social isolation policies earlier to ones that adopted them later.

Their conclusion? “We find that cities that intervened earlier and more aggressively do not perform worse and, if anything, grow faster after the pandemic is over.”

Quote
The takeaway is clear: These policies not only led to better health outcomes, they in turn led to better economic outcomes. Pandemics are very bad for the economy, and stopping them is good for the economy.

https://www.vox.com/future-perfect/2020/3/31/21199874/coronavirus-spanish-flu-social-distancing (https://www.vox.com/future-perfect/2020/3/31/21199874/coronavirus-spanish-flu-social-distancing)

But I know, you just say: 
"That paper wasn't peer reviewed yet."
"This isn't the flu."
"That was then, this is now."

So, whatever.  I'm sure even this administration looked at the best available models of both the possible loss of life and economic costs.  They looked at the trade-offs and made a judgement call.


You say no one can prove it either way, yet in the real world where people just don't argue on the internet, decisions have to be made on imperfect information.  That is what you get paid for.  You can't just throw up your hands and say "you can't prove it either way!"  Tough.  A judgement call has to be made.

On a good note, if you don't agree with the judgement call on quarantine, you'll have the opportunity to express your displeasure officially come the Fall.  ;)


Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 16, 2020, 07:46:59 PM
I never said it could not be proved whether the quarantine work I said you and I can not do so at this time.

I don't see any fault with the conclusions of the paper.but if you notice they didn't take the same measures we did they did normal quarantine and safety precautions i e social distance. They shut down large gatherings like school.

The issue I'm speaking out strictly deals to the stay-at-home type orders. They also did not completely shut down their economy.

your speak of I don't like it therefore I get to vote in december is a cop out on any discussion.

PS I hate doing BBS on a phone.

My main point is that I have not seen any data that supports the conclusion that the stay-at-home orders had any positive effect. that's not the same as saying don't take any precautions many of the precautions as we have taken I agree with.

HiTech.

Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 16, 2020, 08:22:34 PM
The issue I'm speaking out strictly deals to the stay-at-home type orders. They also did not completely shut down their economy.

Neither did we.  I work from home.  So do a lot of people right?  I just ordered $400 bucks worth of stuff off the internet today.   Sounds like commerce to me.

You're still charging $15 a month aren't you?  Sounds like commerce to me.

Apparently we haven't "completely" shut down our economy.

your speak of I don't like it therefore I get to vote in december is a cop out on any discussion.

Uhhhmmm...November I think.  ;)  Oh, wait, we have a special one for people like you in December.  I forgot.  Be sure and wait for that one.  :D


My main point is that I have not seen any data that supports the conclusion that the stay-at-home orders had any positive effect.

No, No, lets play the other way around.

I want you to provide me absolute proof that Stay-at-Home orders had no positive effect.

And don't quote me "PatriotWarriorTreehouseMAGA.c om".  Show me a study that proves that from a US university or Military think-tank, not a website run by someone living in their Mom's basement.  :D

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 16, 2020, 08:30:17 PM
This is not boding well.  :uhoh
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Oldman731 on April 16, 2020, 08:38:08 PM
This is not boding well.


But all the analogies are enjoyable.  Parachutes, seat belts...waiting for the lifeboats and sharks.

- oldman
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 16, 2020, 08:54:17 PM
The real point is that it is generally nonsensical to demand proof that a course of action is best in a situation like this.

There is no proof either way, as Hitech admitted.  Never the less, a decision has to be made by those responsible.  They look at the best models and estimates they have of both epidemiological and economic projections and examine the trade-offs and make a judgement call.  Some one has to make a decision on imperfect information.

A decision occurs when you have imperfect information and no absolute proof and no option that is completely without down side.

If you had absolute proof, that is not even a decision.  That's called arithmetic. 

They looked at the models and estimates they had and decided that a dramatic measure was needed (especially since we were slow to react) to slow down the infections long enough for us to get up to speed and do the preparations needed to face it.  It the short term we can float the economy with national debt (yeah, I know...).  On the other hand, dead people stay dead forever.  Or if they don't, I guess you have bigger problems.

Get used to quarantine.  You will probably see it again at some point over the next 12-18 months.

:salute
 

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 16, 2020, 09:18:20 PM
Look at Canada. While it was also slow to "shut down", the stay at home orders were broadly imposed and while the disease still grows, its expanding at a dramatically slower rate, even in the huge population centers like Toronto, Montreal and Vancouver.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 16, 2020, 09:55:16 PM
I'm really getting tired of these straw men. Please show me where I asked for proof I ask for evidence completely different things.

I can provide evidence that stay at home did nothing take a look at Sweden's numbers take a look at North Dakota's numbers.

Please note I said evidence not proof.
HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 16, 2020, 10:07:20 PM


Quote
Sweden, which is an international outlier in resisting a lockdown, has suffered a much higher death toll than its Nordic neighbours, even adjusting for its population being roughly double that of Norway, Denmark or Finland. As of Wednesday, Sweden had 1,203 deaths due to coronavirus, against 143 for Norway, 309 for Denmark and 72 for Finland.

https://nationalpost.com/news/world/covid-19-as-swedens-death-toll-mounts-epidemiologists-urge-leaders-to-ignore-their-own-public-health-agency (https://nationalpost.com/news/world/covid-19-as-swedens-death-toll-mounts-epidemiologists-urge-leaders-to-ignore-their-own-public-health-agency)
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 16, 2020, 10:14:29 PM
(https://www.dropbox.com/s/pu0k00aaqpoa804/Sweden.png?raw=1)


To me, the important thing to see here isn't the totals, which are never the less illuminating. 

The critical thing to grasp in this chart are the slopes of the disease progression curves.  It is the rate of change that is striking.

Things are getting worse significantly faster in Sweden than it's other Nordic neighbors, regardless of totals, or populations, due to their unwillingness to socially distance. 

Things will continue to get worse significantly faster in Sweden.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: guncrasher on April 16, 2020, 10:20:35 PM
I'm really getting tired of these straw men. Please show me where I asked for proof I ask for evidence completely different things.

I can provide evidence that stay at home did nothing take a look at Sweden's numbers take a look at North Dakota's numbers.

Please note I said evidence not proof.
HiTech

I totally understand what you are saying, but I am not gonna risk my wife, my kids or my grandkids to prove a point.  can my grandkids die due to unforseen forces, yes, but that is down the line.  what we have now is corona virus. maybe later, much later then will die of something else.


semp
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 16, 2020, 11:07:40 PM
I totally understand what you are saying, but I am not gonna risk my wife, my kids or my grandkids to prove a point.



Another way to analyze a problem when the evidence doesn't lend itself to a trivial decision, is to instead flip it around and analyze the costs of being wrong.

If I put a round in a six shot revolver and spin the cylinder and put it to my head, there is only a 16.666% chance I'll blow my brains out. 

I'll spend a dollar on a lotto ticket that has a 16% chance of winning all day long!  But I won't play Russian Roulette with the same odds because the cost of being wrong is so much higher. 

Estimates from epidemiological modelers at the CDC projected possible deaths from COVID-19 of 2.2 million Americans (Assuming no mitigating interventions).

Various people on the internet claim this quarantine will throw us in to a vast, civilization crushing depression.  I've not seen them provide evidence.  As far as I know there is not a technical definition of a depression, unlike a recession.  (Well, the colloquial definition is that a recession is when your neighbor loses his job; a depression is when you lose yours.   ;) )

Generally I would define a depression as a serious recession that probably lasts 3-4 years.  I don't not believe that this will last that long.  If we get a vaccine in 12-18 months or therapeutics even sooner that reduce the risk of this thing to the level of an appendicitis, then I think the recovery will be quite swift.  There is no structural damage.  We are not rebuilding factories razed to the ground after a war.

Even if it was a depression, in my opinion, that does not equate to millions of Americans dead.  Depression in America have been painful and life disrupting for sure.  But I have never seen evidence it has lead to mass casualties.
https://www.smithsonianmag.com/science-nature/great-depression-had-little-effect-on-death-rates-46713514/ (https://www.smithsonianmag.com/science-nature/great-depression-had-little-effect-on-death-rates-46713514/)

So when push comes to shove, I would tilt the decision balance toward accepting economic damage we can repair, against loss of human lives that will be gone forever.  At least at the levels that not having quarantined would have probably led to. 

I'm not saying it has to be maintained forever.  I've outlined, in a previous post, a set of perfectly reasonable exit criteria that I think would allow us to relax quarantine responsibly.  But we needed this emergency intervention to catch our balance.  And eventually the critical rate will climb back up to threaten overloading our health system and we'll have to do it again. Probably in the Fall sometime.

 :salute


Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 16, 2020, 11:53:24 PM

Quote
They accused the government of having failed to draw up a proper strategy, pointing out that the mortality rate in Sweden is now around double that of most of its Nordic neighbours.

Quote
Epidemiology professor Bo Lundback of the University of Gothenburg, slammed the Swedish government as naive and irresponsible.

He said "The authorities and the government stupidly did not believe that the epidemic would reach Sweden at all.

https://www.thesun.co.uk/news/11406152/sweden-highest-coronavirus-deaths-one-day-country-refused-lockdown/ (https://www.thesun.co.uk/news/11406152/sweden-highest-coronavirus-deaths-one-day-country-refused-lockdown/)


Title: Re: Covid 19 Prevention discussion ONLY
Post by: guncrasher on April 17, 2020, 12:14:58 AM


Another way to analyze a problem when the evidence doesn't lend itself to a trivial decision, is to instead flip it around and analyze the costs of being wrong.

If I put a round in a six shot revolver and spin the cylinder and put it to my head, there is only a 16.666% chance I'll blow my brains out. 

I'll spend a dollar on a lotto ticket that has a 16% chance of winning all day long!  But I won't play Russian Roulette with the same odds because the cost of being wrong is so much higher. 

Estimates from epidemiological modelers at the CDC projected possible deaths from COVID-19 of 2.2 million Americans (Assuming no mitigating interventions).

Various people on the internet claim this quarantine will throw us in to a vast, civilization crushing depression.  I've not seen them provide evidence.  As far as I know there is not a technical definition of a depression, unlike a recession.  (Well, the colloquial definition is that a recession is when your neighbor loses his job; a depression is when you lose yours.   ;) )

Generally I would define a depression as a serious recession that probably lasts 3-4 years.  I don't not believe that this will last that long.  If we get a vaccine in 12-18 months or therapeutics even sooner that reduce the risk of this thing to the level of an appendicitis, then I think the recovery will be quite swift.  There is no structural damage.  We are not rebuilding factories razed to the ground after a war.

Even if it was a depression, in my opinion, that does not equate to millions of Americans dead.  Depression in America have been painful and life disrupting for sure.  But I have never seen evidence it has lead to mass casualties.
https://www.smithsonianmag.com/science-nature/great-depression-had-little-effect-on-death-rates-46713514/ (https://www.smithsonianmag.com/science-nature/great-depression-had-little-effect-on-death-rates-46713514/)

So when push comes to shove, I would tilt the decision balance toward accepting economic damage we can repair, against loss of human lives that will be gone forever.  At least at the levels that not having quarantined would have probably led to. 

I'm not saying it has to be maintained forever.  I've outlined, in a previous post, a set of perfectly reasonable exit criteria that I think would allow us to relax quarantine responsibly.  But we needed this emergency intervention to catch our balance.  And eventually the critical rate will climb back up to threaten overloading our health system and we'll have to do it again. Probably in the Fall sometime.

 :salute

no dude, i lost my youngest one and my oldest one.  point to me which child is worth it?



senp
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 17, 2020, 12:25:50 AM
I was agreeing with you.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 17, 2020, 04:36:18 AM
...
My main point is that I have not seen any data that supports the conclusion that the stay-at-home orders had any positive effect. that's not the same as saying don't take any precautions many of the precautions as we have taken I agree with.

HiTech.
    :confused:

Do you need that information in a spreadsheet?


Here is story about what has happened because of a disbelief in the effectiveness of stay-at-home orders.

Smithfield may have infected the entire country.  (Just a guess).

https://www.bbc.com/news/world-us-canada-52311877


BTW, As a side note.

You should not only treat the outside packaging of meat products with care, but also with the inside.  COOK all meats!  I understand that precooked hams sold like mad.  Do not eat the stuff cold.  Heat it up in an oven first please.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 17, 2020, 04:41:03 AM
I started this topic to discuss COVID-19 PREVENTION ISSUES ONLY

If you want to talk about who started it, who failed to see it coming, who has the cure, how many are going to die, why Jesus Christ is going to come down from the heavens above and just take care of business, fine, just start your own topic.

------------------

Well it lasted longer than I originally had guessed it would....

Getting back on track.


https://www.bbc.com/news/av/health-51637561/coronavirus-watch-how-germs-spread


Keep washing your hands!!!   :old:
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 17, 2020, 04:45:05 AM
"Coronavirus symptoms: What are they and how do I protect myself?"

https://www.bbc.com/news/health-51048366


BYW:  Just saw that this IS my 1,000 post!!!    :x :x :cheers: :cheers: :banana: :banana: :banana: :airplane: :airplane: :aok :) :cool: :cool: :cool: :cool: :cool:

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 17, 2020, 04:52:12 AM
I would have less issue with the quarantine if they were not throwing money at them.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 17, 2020, 07:02:36 AM
Trips

So you don't think that this quarantine if extended as some say has to happen would result in a depression like we have never seen?

You don't think printing trillions of dollars out of thin air is going to make the dollar  useless?

Do you not think before that taxes will be raised to historic highs in an attempt to head that off?

You do realize given the unstable environment this country ran on its best day it wouldn't take hardly anything to have the less civilized showing their true colors?

This isn't 1930s America. We do not have the class nor respect we had then. Civil unrest is a stone's throw away as America sinks.

The young and healthy need to go back to work ASAP

The old, those comprised and those they interact with need to take precautions for their own health safety

As what I can tell we have hospital beds empty as the numbers are not as high as the worst thought

Sorry but IMHO a great depression would result in more overall death and misery than if we just tried to get back to somewhat normal as soon the infections flattened- happing now.

We can't be responsible if stupid people don't realize they can't go to a concert and then go visit their 80 year old grandparents

Eagler

Title: Re: Covid 19 Prevention discussion ONLY
Post by: redcatcherb412 on April 17, 2020, 09:51:09 AM
See rule #14
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 17, 2020, 10:33:12 AM
See rule #14
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 17, 2020, 10:39:29 AM
Trips

So you don't think that this quarantine if extended as some say has to happen would result in a depression like we have never seen?

I covered that in my post; did you not read it?

I don' see the point of re-typing it, but I'll add that if we had let 2.2 million Americans die from this thing you also risk economic destruction and social destabilization.

And lifting quarantine right this moment, isn't going to snap the economy back anyway.  I think some people have a delusion about how lifting quarantine will make all this go away.
 Consumers aren't going to pack the malls, or pile into crowded movie theaters, stand in long lines face to face at Six Flags, or squeeze into packed restaurants.  You can't wear mask while eating at a restaurant.  Not to mention the Guatemalan in the kitchen breathing and coughing on your food.  He wasn't feeling well but his crap job doesn't have paid sick  leave, so he decided to just power through.  But the food sure looks good being carried out on that platter past dozens of other tables and through the clouds of respiratory mist from their talking and laughing. 
 
Sorry, I don't see any trivial path through this that doesn't involve some some level of deaths and economic destruction.  The best chance we had of minimizing either would be to have done like South Korea and jump in with both feet, war-time level mobilization of testing, contact tracing and isolating super-spreaders early.  They haven't had enforce across the boards shutdowns.

We chose not to act early and decisively.  We will have a bigger bill to pay, and once an exponential curve gets a head of steam, it takes much more dramatic actions to alter it's trajectory.
 
:salute





Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 17, 2020, 11:00:55 AM
I do not know if this issue is a re-post or not.  But something to keep an eye on.

Short take away maybe that even recovered patients may need to still be careful around others and watch their own health.

https://www.npr.org/sections/coronavirus-live-updates/2020/04/17/836747242/in-south-korea-a-growing-number-of-covid-19-patients-test-positive-after-recover
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 17, 2020, 11:06:12 AM


Quote
The bump in coronavirus cases is most pronounced in states without stay at home orders. Oklahoma saw a 53% increase in cases over the past week, according to data compiled by Johns Hopkins University. Over same time, cases jumped 60% in Arkansas, 74% in Nebraska, and 82% in Iowa. South Dakota saw a whopping 205% spike.
The remaining states, North Dakota, Utah and Wyoming each saw an increase in cases, but more in line with other places that have stay-at-home orders. And all of those numbers may very well undercount the total cases, given a persistent lack of testing across the US.
https://www.cnn.com/2020/04/17/politics/republican-governors-stay-at-home-coronavirus/index.html (https://www.cnn.com/2020/04/17/politics/republican-governors-stay-at-home-coronavirus/index.html)

Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 17, 2020, 11:24:21 AM
https://www.cnn.com/2020/04/17/politics/republican-governors-stay-at-home-coronavirus/index.html (https://www.cnn.com/2020/04/17/politics/republican-governors-stay-at-home-coronavirus/index.html)

Meanwhile, over in Vietnam....

"In Vietnam, There Have Been Fewer Than 300 COVID-19 Cases And No Deaths. Here's Why"

https://www.npr.org/sections/coronavirus-live-updates/2020/04/16/835748673/in-vietnam-there-have-been-fewer-than-300-covid-19-cases-and-no-deaths-heres-why

(I wonder if this will hold).
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 17, 2020, 12:09:28 PM
Correct Trips

The economy will not come back instantly regardless of how long we wait

With the infections curve going down we need to try to reopen ASAP

If new cases spike in some areas those areas make the needed changes for their areas

You can't keep it all closed down any longer than minimally needed

Like the other wars the gov jumps into - they never seem to have a viable exit plan

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 17, 2020, 12:31:36 PM
As the death count is invalid as hospitals are counting deaths as virus caused death when that is not necessarily the case and the fact everyone will never be tested - what is the magic number we are supposed to hit before the all clear can be sounded?

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 17, 2020, 12:34:17 PM
The economy will not come back instantly regardless of how long we wait

Therefore there is not much economic benefit in lifting quarantine before we are ready.

With the infections curve going down we need to try to reopen ASAP

ASAP means "As soon as possible".  In this context it should be redefined as "As soon as prudent".   I've outlined elsewhere exit criteria I think we should achieve before easy restrictions (if you're wanting to do it responsibly).  If you can achieve those next week, I say start lifting the restrictions next week.  If it takes you three weeks, then I say start lifting restrictions in three weeks.

If you lift the restrictions prematurely, all you do is waste the very expensive flattening of the curve we have already purchased.  We have flattened the new cases curve at great cost.  Lets make good use of that.  Let's get our money's worth.   

You can't keep it all closed down any longer than minimally needed

Exactly what I've said.  And I've enumerate the exit conditions I think define "minimally needed".

Like the other wars the gov jumps into - they never seem to have a viable exit plan

The government didn't choose to jump into this war.  The virus reaching our shores was inevitable and involuntary.  The "plan" for the quarantine has always been to slow the spread long enough for us to spool up our readiness and infrastructure so we can address the threat in a controlled, responsible manner.  If anything, we did not "jump" into this war fast enough.  That would have made things easier for us.

:salute


Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 17, 2020, 12:38:06 PM
As the death count is invalid as hospitals are counting deaths as virus caused death when that is not necessarily the case


If anything, the number of Covid-19 deaths are under-counted. 
https://www.nytimes.com/2020/04/05/us/coronavirus-deaths-undercount.html (https://www.nytimes.com/2020/04/05/us/coronavirus-deaths-undercount.html)


How many American deaths would be too many for you?  What's the magic number?

Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 17, 2020, 12:45:11 PM

Quote
there's a growing trend on social media that accuses doctors of saying all deaths are related to the virus to make that official number higher than it should be. 

“I’ve heard of people wondering if COVID-19 is being reported as the cause of death," Dr. Rachel Franklin with OU Med said.  "All I can really tell you is the way causes of death are reported.”

There have been memes and other social media posts claiming the numbers are being exaggerated.

One post saying they were told all "drug overdoses, heart attacks, and other deaths" will be classified as COVID-19.

Healthcare officials say that couldn't be further from the truth. 

https://kfor.com/news/local/doctors-work-to-debunk-myth-that-coronavirus-death-tolls-are-a-hoax/ (https://kfor.com/news/local/doctors-work-to-debunk-myth-that-coronavirus-death-tolls-are-a-hoax/)
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 17, 2020, 12:55:55 PM
If relief $$$ are tied to virus death counts there will be inflated numbers

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 17, 2020, 12:57:00 PM
https://www.cnn.com/2020/04/17/politics/republican-governors-stay-at-home-coronavirus/index.html (https://www.cnn.com/2020/04/17/politics/republican-governors-stay-at-home-coronavirus/index.html)

From the same article.

Quote
The remaining states, North Dakota, Utah and Wyoming each saw an increase in cases, but more in line with other places that have stay-at-home orders.

HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 17, 2020, 01:12:32 PM
From the same article.

Yes.  Of the 8 states refusing to quarantine,  5 have shown significant increases and 3 have not..yet.  5:3.  I consider that pretty compelling evidence.

There are less people living in the entire state of North Dakota than live in the city of Ft. Worth.  They are not particularly representative of the rest of the country, but they too will spike. It might take a little longer given their minuscule population and density.  But they'll eventually get it at their Walmarts or church services, or hanging out with the good ole boys at the county Dairy Queen.


Have you given up on your Sweden argument?   ;)
 

Title: Re: Covid 19 Prevention discussion ONLY
Post by: CptTrips on April 17, 2020, 01:43:03 PM
Sometimes you have to count to 11.

You know, I realize I'm a bit obsessive-compulsive.  I can drive myself crazy if I feel someone is being obtuse.  I have a friend who is a nice guy that is in to all kinds of internet conspiracy stuff.   I know better to hang out with him in situations where the topic might come up because neither one of us will stop until fists fly.   :rofl

So I'm out for a while.  Hope you guys all make to the other side of this. 

Alpha Mike Foxtrot.

(p.s. for those who have my email, always feel free to contact me that way if you need anything like mission related.)



Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 17, 2020, 03:01:39 PM
...

So I'm out for a while.  Hope you guys all make to the other side of this. 

Alpha Mike Foxtrot.


I missed this.  Take care and stay safe.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 17, 2020, 05:22:48 PM
More reasons to use any type of mask:

"Visualizing Speech-Generated Oral Fluid Droplets with Laser Light Scattering"

https://www.nejm.org/doi/full/10.1056/NEJMc2007800?query=featured_home


Also goes over the impact of loudness in speech.....  :evil:

Title: Re: Covid 19 Prevention discussion ONLY
Post by: NatCigg on April 18, 2020, 03:37:37 PM
Simple you show him video of crash test dummy's and the g load data. Then it is no longer opinion/conjecture. Up until then it is.

The point is you look at data with and with out the item you are trying to test, like South Dakota and Sweden.

What you don't do is blindly assume that confining people to their house , is better then other forms of prevention.

HiTech

A q and A with Korea's Fauchi
They keep confirmed cases in a treatment center. not, go home spread it in your house and call if you think you will die.



Title: Re: Covid 19 Prevention discussion ONLY
Post by: AKKuya on April 18, 2020, 09:12:22 PM
Florida governor opened up the beaches and hundreds to thousands around the state flocked to them.  This will be a test to see if people can resume being near each other.  If the infection rates spike and more people die, then re-opening the country will most likely fail.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Spikes on April 18, 2020, 09:14:34 PM
Florida governor opened up the beaches and hundreds to thousands around the state flocked to them.  This will be a test to see if people can resume being near each other.  If the infection rates spike and more people die, then re-opening the country will most likely fail.
It was a dumb idea to begin with.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 18, 2020, 09:52:00 PM
If the infection rates spike and more people die...........

I for one believe this is a certainty.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Chalenge on April 19, 2020, 06:02:04 PM
The U.K. just extended the stay-at-home order indefinitely, or until there is a vaccine. I believe that Dr. Shiva hit the nail on the head when he stated that the most likely outcome will be a perpetual state of vaccinations and record updates will be in our future, and that the Gates Foundation will likely become the new landlord of society.

BTW, 50% of the kids in the Philippines that received the Gates Foundation anti-polio vaccine contracted polio from the vaccine. Just saying.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: guncrasher on April 19, 2020, 06:10:49 PM
The U.K. just extended the stay-at-home order indefinitely, or until there is a vaccine. I believe that Dr. Shiva hit the nail on the head when he stated that the most likely outcome will be a perpetual state of vaccinations and record updates will be in our future, and that the Gates Foundation will likely become the new landlord of society.

BTW, 50% of the kids in the Philippines that received the Gates Foundation anti-polio vaccine contracted polio from the vaccine. Just saying.

last i heard it was 100 %


semp
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 19, 2020, 06:41:50 PM
last i heard it was 100 %


semp

Not my words but worthy note:

"Despite the promising coverage, the circulating poliovirus still pose tremendous risk to children, until one child remains infected and not fully vaccinated. This is evidenced by the recent increase in confirmed cases,” said UNICEF Philippines Representative Oyun Dendevnorov. “UNICEF is working in collaboration with DOH, WHO and other partners, to boost up vaccination coverage. We must continue to strive together to reach all target population in the upcoming rounds of immunization. Polio has no cure; complete vaccination offers the only chance to protect our children and to eliminate polio from the Philippines once again.”

UNICEF and WHO have been supporting DOH and the Ministry of Health of the Bangsamoro Autonomous Region in Muslim Mindanao (BARMM) in its Sabayang Patak Kontra Polio vaccination campaigns and monitoring of the polio outbreak. Both organizations are long-standing partners of the Philippine Government in working towards routine immunization for all children in the country.

Parents and guardians are urged to have all children under five years vaccinated in the ongoing rounds of Sabayang Patak Kontra Polio from 20 January to 2 February in all regions of Mindanao, and 27 January to 7 February in NCR.

The transmission of polio, spread through faecal-oral route, can only be stopped if the immunisation coverage reaches over 95% of the targeted children. The risk cannot be mitigated as long as some children are not vaccinated regularly and especially during an outbreak.

 
Title: Re: Covid 19 Prevention discussion ONLY
Post by: guncrasher on April 19, 2020, 07:16:37 PM
sorry I mean it was 100% bs not 50%.  last I heard


semp
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Maverick on April 20, 2020, 10:15:51 AM
The TX governor just announced that there would be a reduction in restrictions, first state in the nation to do so, coming soon. His office would announce a schedule as to class or types of businesses to be allowed open. Schools will remain closed for the remainder of the school year.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 20, 2020, 10:23:44 AM
The TX governor just announced that there would be a reduction in restrictions, first state in the nation to do so, coming soon. His office would announce a schedule as to class or types of businesses to be allowed open. Schools will remain closed for the remainder of the school year.

In our area there are still many businesses operating as oil and petrochemical, NASA, military, and other industries here along with support.

Our shop has not missed a beat. Traffic on the roads has been a bit less though. Not every business is open.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Mister Fork on April 20, 2020, 12:39:44 PM
The TX governor just announced that there would be a reduction in restrictions, first state in the nation to do so, coming soon. His office would announce a schedule as to class or types of businesses to be allowed open. Schools will remain closed for the remainder of the school year.

1 month from now...

In the lastest COVID-19 updates, Texas reports a huge spike in new cases. In a statement from Texas Governor Greg Abbott, social distancing and work-from-home restrictions are back in place, in addition to the reduction of listed essential businesses to hospitals, gas stations,and grocery stores. The new restrictions are due to the drastic increase in new cases over the past two weeks largely blamed on Abbott's lifting of the restrictions late April. Andrew Cuomo, governor of New York has offered Abbott spare respirators for the slammed hospital facilities in Dallas and Houston who have reported dramatic increase in the demand for these medical devices. Governor Abbott has also reached out to President Trump seeking additional funding support and has called in the National Guard to enforce re-instated social distancing measures on the expected backlash from certain groups on these new measures.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Copprhed on April 20, 2020, 02:46:24 PM
The TX governor just announced that there would be a reduction in restrictions, first state in the nation to do so, coming soon. His office would announce a schedule as to class or types of businesses to be allowed open. Schools will remain closed for the remainder of the school year.
A great way to cull the herd.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Volron on April 20, 2020, 03:36:37 PM
1 month from now...

In the lastest COVID-19 updates, Texas reports a huge spike in new cases. In a statement from Texas Governor Greg Abbott, social distancing and work-from-home restrictions are back in place, in addition to the reduction of listed essential businesses to hospitals, gas stations,and grocery stores. The new restrictions are due to the drastic increase in new cases over the past two weeks largely blamed on Abbott's lifting of the restrictions late April. Andrew Cuomo, governor of New York has offered Abbott spare respirators for the slammed hospital facilities in Dallas and Houston who have reported dramatic increase in the demand for these medical devices. Governor Abbott has also reached out to President Trump seeking additional funding support and has called in the National Guard to enforce re-instated social distancing measures on the expected backlash from certain groups on these new measures.


Pretty much this, if not worse.  Thing is, they ain't enforcing jack around here right now, as I see folks just lolly-gagging all over the damn place.  Wish I got hazard pay...
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Chalenge on April 20, 2020, 04:54:52 PM
sorry I mean it was 100% bs not 50%.  last I heard


Never sure exactly what you mean semp.

When I checked into the details of the vaccination program it turned out that the kids in Mindanao were only given the oral treatment, but never received the injection. Unless you receive both you are still vulnerable. So, as the numbers fell 6 out of 10 kids, in the end, completed immunization. Unless they all do the virus still exists in the wild and will reappear.

Not to fear, though. I'm sure Gates got his money.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 20, 2020, 05:08:43 PM
1 month from now...

In the lastest COVID-19 updates, Texas reports a huge spike in new cases. In a statement from Texas Governor Greg Abbott, social distancing and work-from-home restrictions are back in place, in addition to the reduction of listed essential businesses to hospitals, gas stations,and grocery stores. The new restrictions are due to the drastic increase in new cases over the past two weeks largely blamed on Abbott's lifting of the restrictions late April. Andrew Cuomo, governor of New York has offered Abbott spare respirators for the slammed hospital facilities in Dallas and Houston who have reported dramatic increase in the demand for these medical devices. Governor Abbott has also reached out to President Trump seeking additional funding support and has called in the National Guard to enforce re-instated social distancing measures on the expected backlash from certain groups on these new measures.

I really agree with you and I am at a complete loss to understand why any of the people in private or public authority belittle the danger of this disease. Save lives; the economy will recover afterwards. When medical science can say that this pandemic is beaten, I believe the resulting optimism will lead to a real upbeat in the economy.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 20, 2020, 05:50:30 PM
(https://i.imgur.com/o5Ilb5a.png)
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Slate on April 20, 2020, 08:59:29 PM
  Never got a flu shot and I haven't died from it yet. Many more die each year from the Flu than Covid-19 mostly because they are already compromised.
  Not smart or healthy to protect the "Herd" by shutting them away in the barn. Learn the lessons and start helping the "Herd" have healthier lifestyles to build an immune response.
    Drug companies have not made people healthier only more dependent. There is no real Flu Vaccine, those that get it still get sick.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hazmatt on April 20, 2020, 09:30:39 PM
I haven't had the Flu since I stopped getting the shot. Not sure if it's coincidental. Just an observation.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: NatCigg on April 21, 2020, 07:12:12 AM
  Never got a flu shot and I haven't died from it yet. Many more die each year from the Flu than Covid-19 mostly because they are already compromised.
  Not smart or healthy to protect the "Herd" by shutting them away in the barn. Learn the lessons and start helping the "Herd" have healthier lifestyles to build an immune response.
    Drug companies have not made people healthier only more dependent. There is no real Flu Vaccine, those that get it still get sick.

1. Covid has not been around for a year yet, so we can not compare year vs. year, yet.
2. first year stats from covid will be skewed by social distancing laws.
3. you will kill a good chunk of the heard if you let this disease go on its own. sure, comparing this year to two years from now, not as many would die in two years and infections would be less.  But, this year you wiped out 3-10 million of your herd to gain that "immunity".
4. Drug companies save everyone's lives, every year.  Run down your childs vaccine records then research history to check how bad life was. I dont see anyone walking with a polio limp anymore! how about a measles outbreak?  Seems like almost all kids go though school without horrific outcomes that were normal, just 80 years ago.

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Firetech on April 21, 2020, 07:38:11 AM
1. Covid has not been around for a year yet, so we can not compare year vs. year, yet.
2. first year stats from covid will be skewed by social distancing laws.
3. you will kill a good chunk of the heard if you let this disease go on its own. sure, comparing this year to two years from now, not as many would die in two years and infections would be less.  But, this year you wiped out 3-10 million of your herd to gain that "immunity".
4. Drug companies save everyone's lives, every year.  Run down your childs vaccine records then research history to check how bad life was. I dont see anyone walking with a polio limp anymore! how about a measles outbreak?  Seems like almost all kids go though school without horrific outcomes that were normal, just 80 years ago.
This guy gets it  :aok
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Copprhed on April 21, 2020, 08:25:24 AM
I haven't had the Flu since I stopped getting the shot. Not sure if it's coincidental. Just an observation.
Gee, I haven't lost my home to a tornado since I stopped picking my nose, just an observation....
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 21, 2020, 09:55:03 AM
I know that some here think that they know better, whatever....  The worst is yet to come.

Please use masks, stay home and if you must go out stay 10 feet apart.

And, if you are young and healthy, ask your neighbor if they are OK and if they need anything.


"WHO warns that few have developed antibodies to Covid-19

Herd immunity hopes dealt blow by report suggesting only 2%-3% of people have been infected"

https://www.theguardian.com/society/2020/apr/20/studies-suggest-very-few-have-had-covid-19-without-symptoms
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 21, 2020, 01:54:26 PM
I know that some here think that they know better, whatever....  The worst is yet to come.

Please use masks, stay home and if you must go out stay 10 feet apart.

And, if you are young and healthy, ask your neighbor if they are OK and if they need anything.


"WHO warns that few have developed antibodies to Covid-19

Herd immunity hopes dealt blow by report suggesting only 2%-3% of people have been infected"

https://www.theguardian.com/society/2020/apr/20/studies-suggest-very-few-have-had-covid-19-without-symptoms

A different way of looking at it from the same sight.
https://www.theguardian.com/world/2020/apr/17/antibody-study-suggests-coronavirus-is-far-more-widespread-than-previously-thought
One of the key parts.
Quote
The study marks the first large-scale study of its kind in the US, researchers said. The study was conducted by identifying antibodies in healthy individuals through a finger salamander test, which indicated whether they had already contracted and recovered from the virus. Volunteers for the study were recruited through Facebook ads, which researchers say were targeted to capture a representative sample of the county’s demographics and geography.
Advertisement

At the time of the study, Santa Clara county had 1,094 confirmed cases of Covid-19, resulting in 50 deaths. But based on the rate of participants who have antibodies, the study estimates it is likely that between 48,000 and 81,000 people had been infected in Santa Clara county by early April.

That also means coronavirus is potentially much less deadly to the overall population than initially thought. As of Tuesday, the US’s coronavirus death rate was 4.1% and Stanford researchers said their findings show a death rate of just 0.12% to 0.2%.

So now consider that if far more people.

1. The possibility to contain it becomes impossible.
2. The odds of creating a vaccination soon enough to have a significant impact on most of the population is small.
3. All we are doing is possibly  slowing the spread, but in the end we will still have to reach heard immunity.
4. The 2 = 3% number is in a non crisis area. If you do New York State with the same numbers working backwards from the death rate.
     NY State had 14,828 deaths. With a 0.12% - 0.20 death rate that works out to about to between 11.7   to million 7 people. So NY State has approximately 20 million. so between 35% and 58% of the people would have all ready been infected. Those numbers are approaching herd immunity, And could possibly be a major reason the new infection rate is dropping.

So now is it better to try isolate every one , or try to just isolate the high risk population?

HiTech




HITech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 21, 2020, 02:11:16 PM
In Texas, as of today, deaths from Corona virus stand at 0.0000172%.

Total for the state... 517.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Firetech on April 21, 2020, 04:40:05 PM
The isolation guidelines are well published to help "flatten the curve" as in not overwhelm our ability to treat seriously ill folks and possibly save some along the way. The total numbers of infections don't really drop, they just spread out over the course of many months. New York is the US example to look at what happens when hospitals get overloaded. Many more die due to lack of resources. We don't yet know how many died that normally would have been saved due to other life threatening emergencies.

In Texas, as of today, deaths from Corona virus stand at 0.0000172%.

Total for the state... 517.
That is a huge win! Thanks to all the distancing! Also, folks having every day run of the mill emergencies like heart attacks, strokes, diabetic comas, car accidents and so on are able to be seen and treated in the proper time frames. Our hospitals and medical offices are not busting at the seams with COVID-19 patients.

Quote
3. All we are doing is possibly  slowing the spread, but in the end we will still have to reach heard immunity.
Has there been a peer reviewed study done if herd immunity can be reached with this virus?
Title: Re: Covid 19 Prevention discussion ONLY
Post by: redcatcherb412 on April 21, 2020, 07:18:21 PM
The isolation guidelines are well published to help "flatten the curve" as in not overwhelm our ability to treat seriously ill folks and possibly save some along the way. The total numbers of infections don't really drop, they just spread out over the course of many months. New York is the US example to look at what happens when hospitals get overloaded. Many more die due to lack of resources. We don't yet know how many died that normally would have been saved due to other life threatening emergencies.
That is a huge win! Thanks to all the distancing! Also, folks having every day run of the mill emergencies like heart attacks, strokes, diabetic comas, car accidents and so on are able to be seen and treated in the proper time frames. Our hospitals and medical offices are not busting at the seams with COVID-19 patients.
A bit of a change from 3 weeks ago when they changed EMT rules for 'run of the mill' emergencies that might stop your heart from beating like heart attack, car crash, massive bleeding etc etc.

As the coronavirus stretches New York City emergency rooms and paramedics to their limits, a regional EMT group has issued new guidelines almost unthinkable even days ago -- if someone's in cardiac arrest and you can't revive them in the field, don't bring them to the emergency room.

The newly implemented order that takes effect Thursday was implemented in an effort to control the surge of patients in hospitals due to the ongoing COVID-19 pandemic.


The guidance from the Regional Emergency Medical Services Council of New York City applies to the city as well as Nassau and Suffolk counties. The group, known as REMSCO, is the state-designated coordinating authority for the region.


Title: Re: Covid 19 Prevention discussion ONLY
Post by: redcatcherb412 on April 21, 2020, 07:42:28 PM
More reasons to use any type of mask:

"Visualizing Speech-Generated Oral Fluid Droplets with Laser Light Scattering"

https://www.nejm.org/doi/full/10.1056/NEJMc2007800?query=featured_home


Also goes over the impact of loudness in speech.....  :evil:

Wear a mask, no don't wear a mask,  no no wear one ,  but maybe they won't help.  The back and forth of just this one item is getting to the point of ridiculous when WHO, who biffed their job as of a few weeks ago STILL confuses things even more.

there  is  currently  no  evidence that wearing a mask (whether medical or other types)by healthy persons in the wider community setting, including universal   community   masking,   can   prevent   them   from   infection with respiratory viruses, including COVID-19.

https://apps.who.int/iris/bitstream/handle/10665/331693/WHO-2019-nCov-IPC_Masks-2020.3-eng.pdf?sequence=1&isAllowed=y
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 21, 2020, 08:50:15 PM
when WHO, who biffed their job as of a few weeks ago STILL confuses things even more.

sequence=1&isAllowed=y

The WHO biffed their job? Damn, I always have a problem with January 30 to March 13 every year. Must have slept through it.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: guncrasher on April 21, 2020, 09:51:46 PM
Wear a mask, no don't wear a mask,  no no wear one ,  but maybe they won't help.  The back and forth of just this one item is getting to the point of ridiculous when WHO, who biffed their job as of a few weeks ago STILL confuses things even more.

there  is  currently  no  evidence that wearing a mask (whether medical or other types)by healthy persons in the wider community setting, including universal   community   masking,   can   prevent   them   from   infection with respiratory viruses, including COVID-19.

https://apps.who.int/iris/bitstream/handle/10665/331693/WHO-2019-nCov-IPC_Masks-2020.3-eng.pdf?sequence=1&isAllowed=y


I dont think wearing a regular mask or home made one will help in any way.  but it does remind  those around to keep their distance.  so over all and specially if everybody has one it will reduce rate of infection.  that's what I think anyway, along with washing hands.


semp
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 22, 2020, 01:40:08 AM
Wearing one definitely makes it easier for criminals. Just like the masked guy who sucker punched a cop recently.

I do steer clear of those in mask. More so because if you are sick or around those who are, they suggest you wear one.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Nilsen on April 22, 2020, 03:41:52 AM
I spent 4 hours today taking masks & sterile medical gloves from our family stock and passing them out to my elderly neighbors....

I'm fortunate to have such a supply thanks to my oldest daughter, Sister and her 3 daughters all worked in the medical field......2 of my nieces still do

Neighbors asked me how much I wanted, told them nothing and to call if I could be of help

Cool!  :aok
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 22, 2020, 09:11:49 AM
Quote
There is no empirical evidence for these lockdowns

https://www.spiked-online.com/2020/04/22/there-is-no-empirical-evidence-for-these-lockdowns/

The article describes a lot of what I was posting about my questions on lock downs.

HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Vulcan on April 22, 2020, 05:26:17 PM
https://www.spiked-online.com/2020/04/22/there-is-no-empirical-evidence-for-these-lockdowns/

The article describes a lot of what I was posting about my questions on lock downs.

HiTech

We are doing pretty well in NZ with lock down. Our Covid19 new detections are dropping off rapidly, we're down to 4 or 5 new per day. Deaths are low (12 people out a ~5.5 mill population). Nearly all the deaths are related to rest home clusters with over 70 year olds with health complications.

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 22, 2020, 05:38:39 PM
We are doing pretty well in NZ with lock down. Our Covid19 new detections are dropping off rapidly, we're down to 4 or 5 new per day. Deaths are low (12 people out a ~5.5 mill population). Nearly all the deaths are related to rest home clusters with over 70 year olds with health complications.

I would like to ask... It seems in Canada that opposing politicians who are usually at one another's throats, are now quite united in their actions to fight and contain this disease. Is it similar in New Zealand?
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 22, 2020, 05:59:32 PM
See rule 14 & 4.
You were just fine until your last paragraph.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: SysError on April 22, 2020, 06:30:54 PM
I am done

Thanks for all the fish
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Vulcan on April 22, 2020, 10:22:35 PM
I would like to ask... It seems in Canada that opposing politicians who are usually at one another's throats, are now quite united in their actions to fight and contain this disease. Is it similar in New Zealand?

Nah, we're arguing whether we could've done better but closing the borders sooner.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Tilt on April 23, 2020, 05:18:19 AM
A different way of looking at it from the same sight.
https://www.theguardian.com/world/2020/apr/17/antibody-study-suggests-coronavirus-is-far-more-widespread-than-previously-thought
One of the key parts.
So now consider that if far more people.

1. The possibility to contain it becomes impossible.
2. The odds of creating a vaccination soon enough to have a significant impact on most of the population is small.
3. All we are doing is possibly  slowing the spread, but in the end we will still have to reach heard immunity.
4. The 2 = 3% number is in a non crisis area. If you do New York State with the same numbers working backwards from the death rate.
     NY State had 14,828 deaths. With a 0.12% - 0.20 death rate that works out to about to between 11.7   to million 7 people. So NY State has approximately 20 million. so between 35% and 58% of the people would have all ready been infected. Those numbers are approaching herd immunity, And could possibly be a major reason the new infection rate is dropping.

So now is it better to try isolate every one , or try to just isolate the high risk population?


HITech


I agree that all measures seem targeted at slowing stuff down to enable the various health services to cope.
In the UK this has three facets.

1)Social distancing... we still go out for "essential" stuff.
2)Lock down..... we are "locked down" but as per above go out for essential stuff when we exercise social distancing.
3)Isolation...my son is diabetic..... my mother is 94 both are under so called isolation...….ie full lock down for 12 weeks. My mother still went to the local clinic for her beta injections.

Whilst also reducing the load on our health service, only isolation protects the individual in a direct manner. Lockdown and social distancing IMO are about containing spread.

Clearly "efficient" voluntary social distancing may be sufficient but  the evidence is that, in the west, its not possible to obtain unless enforced by a form of lockdown.

Boffins in the UK tell us herd immunity would only be reached when (depending upon source) 70-90% of the population are immune. Herd immunity is defined thru an "acceptable" level of deaths...the actual value of "acceptable" in this case is not often discussed. At the present rate of contagion even given the masses of unregistered infections natural herd immunity is considered to be unachievable unless re enforced by vaccine...…. particularly from those defining it by the higher percentile. But the common thought is that this (with help from vaccine) is upto 12months away.

Herd immunity is a political mine field and now considered an unacceptable dialogue , yet clearly (even if given another name) it has to be the end goal. If/when life returns to some level of normality it will be because COVID 19 is considered to be at an "acceptable"  (tolerable?) level.

So what is an acceptable death rate for COVID19?

It's widely considered that the UK lockdown/social distancing has now flattening the curve which is going through its peak. We are at ~20,000 deaths (adding unregistered care home deaths to the hospital stats) and we can pretty much see that the tail of the curve will have twice the volume of the head. That would equate to 60,000 deaths (20k+40K) assuming that all these measures stayed in place.... with the prospect that we would still not reach herd immunity.

Our yearly flu death rate varies between 12,000 -20,000 …….we have herd immunity for types A&B flu. The view is that that COVID19 will not go away and every year, whilst it will cull some of the flu numbers (and vice versa) its looking like it could be adding  ~ 10,000 to those numbers every year. that with a population of some 66M

Face masks...….. if someone is infectious, then wearing a face mask will protect those not infected...…….. to some degree. Wearing one to avoid infection seems  to be less effective.

Social distancing...…. clearly avoiding human contact reduces risk.....more avoidance = less risk


Title: Re: Covid 19 Prevention discussion ONLY
Post by: 100Coogn on April 23, 2020, 06:49:14 AM
Does this dress make me look fat?

Coogan
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 23, 2020, 06:52:06 AM
By the end of today more than 1 in 5 Americans will be unemployed.

Those are only the numbers that have been able to register for unemployment

Many more cannot as the system was never designed for such numbers

As talk starts about how we are going to try to unlock the lock down, seems very clear to me this will not be the "V" recovery some are hoping for

As soon as they stop the printing presses, more will be hurting

Then comes the pain caused by all the $$ printing

Oh yeah then there is the virus that caused this mess, it isn' t going anywhere soon...

It does not look good at all at this point

Eagler

Title: Re: Covid 19 Prevention discussion ONLY
Post by: NatCigg on April 23, 2020, 07:27:25 AM
https://qcostarica.com/hydroxychloroquine-the-drug-costa-rica-uses-successfully-to-fight-covid-19/

some good news. Costa Rica has a death rate of 0.5%. (compare to Michigan (8.3%)

Maybe because of their rational use of drugs.  using antiviral hydroxychloroquine early in disease, NOT for severe patients only.

 Be careful out there! the information is twisted and politicized.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 23, 2020, 09:21:13 AM
Quote
UN warns of 'biblical' famines of a quarter of a billion people as coronavirus threatens to leave three dozen nations starving

https://www.dailymail.co.uk/news/article-8239619/UN-warns-biblical-famines-coronavirus-threatens-leave-three-dozen-nations-starving.html

There could also be huge down side if lock downs continue to long.

HiTech
Title: Re: Covid 19 Prevention discussion ONLY
Post by: mora on April 24, 2020, 02:40:03 AM
Rimdesivar failed? https://www.bbc.com/news/world-52406261 (https://www.bbc.com/news/world-52406261)
Title: Re: Covid 19 Prevention discussion ONLY
Post by: redcatcherb412 on April 24, 2020, 09:20:22 AM
Does this dress make me look fat?

Coogan

I've heard it's just the fat that makes folks look fat, do tell.  :rofl
Title: Re: Covid 19 Prevention discussion ONLY
Post by: 1stpar3 on April 26, 2020, 12:09:07 AM
I've heard it's just the fat that makes folks look fat, do tell.  :rofl
REd...Grnd, the proper answer to that question,is..."Do I LOOK STUPID?" NEVER answer that question! :bhead  Just looking out for ya :police: Wait...dont answer either question..I wasnt asking if I looked :furious nevermind... love ya, Brother/Fav target :salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: redcatcherb412 on April 26, 2020, 11:03:15 AM
REd...Grnd, the proper answer to that question,is..."Do I LOOK STUPID?" NEVER answer that question! :bhead  Just looking out for ya :police: Wait...dont answer either question..I wasnt asking if I looked :furious nevermind... love ya, Brother/Fav target :salute
Ahhh yes, my fav egg dispenser, over easy on target  :airplane:
 :salute
Title: Re: Covid 19 Prevention discussion ONLY
Post by: MiloMorai on April 27, 2020, 05:57:34 AM
See rule #14
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Maverick on April 27, 2020, 10:15:50 AM
See rule #14
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 27, 2020, 10:21:46 AM
Perhaps
One
Listens
Intently
To
Ideology
Canceling
All
Logic?
Title: Re: Covid 19 Prevention discussion ONLY
Post by: LCADolby on April 27, 2020, 10:28:03 AM
See rule #2
Title: Re: Covid 19 Prevention discussion ONLY
Post by: DmonSlyr on April 27, 2020, 12:50:04 PM
See rule #2 and 14
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TheBug on April 27, 2020, 01:02:59 PM
See rule #4
Title: Re: Covid 19 Prevention discussion ONLY
Post by: DmonSlyr on April 27, 2020, 01:23:01 PM
See rule #4

Title: Re: Covid 19 Prevention discussion ONLY
Post by: TyFoo on April 27, 2020, 01:28:36 PM
See rule #2
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 27, 2020, 02:10:29 PM
See rule #14
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Firetech on April 27, 2020, 02:11:10 PM
See rule #2 and 14
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 27, 2020, 02:19:19 PM
21 pages. Knew there was a reason. And there is no common factor in what ends threads politically.  :old:
Title: Re: Covid 19 Prevention discussion ONLY
Post by: DmonSlyr on April 27, 2020, 02:32:53 PM
See rule 14
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 27, 2020, 03:54:48 PM
See rule #14
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 27, 2020, 03:56:14 PM

You are the one supporting a former Ethopian official in charge of the WHO while discrediting them when it comes to plane crashes. Just saying...


This is really getting tiresome. I have no idea how what I said gives you some link to the WHO.

I really couldn't care less where the virus came from. It's meaningless to the solution. Science will find better treatments and  a vaccine, hopefully sooner than later. If it makes you feel better to find someone to blame for this crisis, knock yourself out.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 27, 2020, 04:07:00 PM
I have to disagree with you there Busher. It is important to find where a problem, any problem, starts. It is the only way to address the problem and hopefully not repeat it. Don't look at that part as "blame". It is very important that we find where it came from and how so we can prevent another outbreak.

Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 27, 2020, 04:30:39 PM
I have to disagree with you there Busher. It is important to find where a problem, any problem, starts. It is the only way to address the problem and hopefully not repeat it. Don't look at that part as "blame". It is very important that we find where it came from and how so we can prevent another outbreak.

If we were talking about anything but a virus, I would agree with your comments. But if you study the science of virology (and God knows my knowledge is as limited as most), you will see that these organisms mutate and science does not yet know how to prevent this from happening, nor do they know how to prevent them from becoming deadly.
Viruses are found in almost every ecosystem on Earth and are the most numerous type of biological entity so until we can learn to control this organism, we will continue to play catch-up.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: mikeWe9a on April 27, 2020, 04:40:53 PM
last i heard it was 100 %


semp

There isn't anyone on the PLANET dumb enough to believe that.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Firetech on April 27, 2020, 04:51:03 PM
There isn't anyone on the PLANET dumb enough to believe that.

On the round planet, that is true. The flat planet.. not so much.


Not sure if these we're posted earlier but kind of interesting. Had to watch for work.

https://www.covid19conversations.org/webinars/science-of-social-distancing-1 (https://www.covid19conversations.org/webinars/science-of-social-distancing-1)

https://www.covid19conversations.org/webinars/science-of-social-distancing-2 (https://www.covid19conversations.org/webinars/science-of-social-distancing-2)

Title: Re: Covid 19 Prevention discussion ONLY
Post by: redcatcherb412 on April 27, 2020, 06:48:17 PM
https://www.dailymail.co.uk/news/article-8239619/UN-warns-biblical-famines-coronavirus-threatens-leave-three-dozen-nations-starving.html

There could also be huge down side if lock downs continue to long.

HiTech
Just think how much shorter the war could have been. How many thousands of names would not be on the Wall. 
If the year of TET 1968, and the pandemic of Hong Kong flu that killed 100,000 in the U.S. and over a million worldwide.
There could have been a lock down on the scale of today with the half million deployed brought home out of the Asian virus zone like they pulled all the Americans out of the zone a few months ago.
They closed down nothing in 1968, locked down no one and yet here they are, over halfway to matching the deaths with covid and locking up the world and ruining untold numbers of businesses and economies.
Strange how that works out.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: guncrasher on April 27, 2020, 09:13:32 PM
See rule 14
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 28, 2020, 06:33:25 AM
If this was not a weapon to start I see it becoming one..

It has been able to do in 60 days what terrorism has failed to do in 20 years.

<S>

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 28, 2020, 06:39:43 AM
If this was not a weapon to start I see it becoming one..

It has been able to do in 60 days what terrorism has failed to do in 20 years.

It's not the weapon. What is has been around longer than 20 years.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 28, 2020, 07:03:19 AM
It should be/ will be going forward

Atoms were around forever b4 someone discovered how to split one and make a very big mess

<S>

Eagler

Title: Re: Covid 19 Prevention discussion ONLY
Post by: NatCigg on April 28, 2020, 08:15:15 PM
Perhaps
One
Listens
Intently
To
Ideology
Canceling
All
Logic?

 :aok
Title: Re: Covid 19 Prevention discussion ONLY
Post by: NatCigg on April 28, 2020, 08:28:20 PM
If this was not a weapon to start I see it becoming one..

It has been able to do in 60 days what terrorism has failed to do in 20 years.

<S>

Eagler

i see it a valiant yet somewhat naive attempt to save life.  interesting to see how it plays out.  quite worrisome we spent so much money and very few have got the disease.  the long road ahead looks looooong.

Any news on those treatments? i hear new york finished one last week and release could have been monday.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TheBug on April 28, 2020, 09:28:17 PM
If this was not a weapon to start I see it becoming one..

It has been able to do in 60 days what terrorism has failed to do in 20 years.

<S>

Eagler

Of course it is a weapon.  Just not unleashed by man.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: guncrasher on April 28, 2020, 09:53:48 PM
Of course it is a weapon.  Just not unleashed by man.

makes sense, you dont unleash a weapon that can k, ha whatever, conspiracy is just as powerful as alcohol.


semp
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 29, 2020, 10:24:58 AM
Of course it is a weapon.  Just not unleashed by man.

Maybe maybe not but it definitely was not reported by the host country when it should have been

It sounds like that info was purposely witheld until it had spread across the globe

That discussion is coming...

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: redcatcherb412 on April 29, 2020, 11:22:58 AM
Of course it is a weapon.  Just not unleashed by man.
Sure was humans that took it out of the bottle, modified it repeatedly, tested it and put it back in a bottle.

What is unknown if a single person clumsily handled it releasing it accidentally or someone/something more
nefarious opened that bottle for the world to enjoy.

Probably will never find out for sure. If accidental, that person is probably not living.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TheBug on April 29, 2020, 11:28:49 AM
Sure was humans that took it out of the bottle, modified it repeatedly, tested it and put it back in a bottle.



You can prove this?
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 29, 2020, 11:33:55 AM
You can prove this?

Guess he can imagine it and that's good enough.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 29, 2020, 11:36:07 AM
Sure was humans that took it out of the bottle, modified it repeatedly, tested it and put it back in a bottle.

What is unknown if a single person clumsily handled it releasing it accidentally or someone/something more
nefarious opened that bottle for the world to enjoy.

Probably will never find out for sure. If accidental, that person is probably not living.

You guys make me laugh. Science has already proven that this virus was not engineered but go ahead and believe those that would rather enhance hate on some enemy - any enemy for that matter. But I guess those educated scientists must be wrong, because the PTB's neither believe them nor will they relinquish control of the path to the solution.

China warned the world of the dangers of Covid on Dec 31,2019. Sadly it took until Jan 30,2020 for the WHO to declare a world health emergency. Seems there was a lack of communication somewhere because March 13, 2020 doesn't seem to me as an intelligent response.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: 1stpar3 on April 29, 2020, 02:26:01 PM
 :uhoh I dont have a "timeline" infront of me at this second...so this is JUST A QUESTION. "CHINA" warned the world? As I remember there was a DOCTOR, in China that was trying to blow the whistle? It was because China tried to silence said Dr.(and eventually he was be it Cov or FMJ) is why the W.H.O was late acknowledging the danger? It doesnt matter really. WHO is corrupted, CHINA made it, ITS a weapon, The AP says, Q said,FoxNews said,FauxNews said, LEFT TWIX NO RIGHT TWIX  is meaningless now. We can argue that stoole till the end. Views one way or the other doesnt matter...WE ARE ALL IN THE SAME BOAT NOW   I dont care if you are man made..natural enhanced or what ever you are....instead of throwing water into said boat, just acknowledge someone looks and things different, and just Row Row Row...whomever the Captain is I aint seen proof that this boat even has a Wheel let alone a Rudder. I know I am not in charge and both sides of any Rowing Team have to work together. Eh doesnt matter just hate all this bickering, this will only make the coming storm, that much harder to navigate :bhead
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TheBug on April 29, 2020, 02:40:37 PM
:uhoh I dont have a "timeline" infront of me at this second...so this is JUST A QUESTION. "CHINA" warned the world? As I remember there was a DOCTOR, in China that was trying to blow the whistle? It was because China tried to silence said Dr.(and eventually he was be it Cov or FMJ) is why the W.H.O was late acknowledging the danger? It doesnt matter really. WHO is corrupted, CHINA made it, ITS a weapon, The AP says, Q said,FoxNews said,FauxNews said, LEFT TWIX NO RIGHT TWIX  is meaningless now. We can argue that stoole till the end. Views one way or the other doesnt matter...WE ARE ALL IN THE SAME BOAT NOW   I dont care if you are man made..natural enhanced or what ever you are....instead of throwing water into said boat, just acknowledge someone looks and things different, and just Row Row Row...whomever the Captain is I aint seen proof that this boat even has a Wheel let alone a Rudder. I know I am not in charge and both sides of any Rowing Team have to work together. Eh doesnt matter just hate all this bickering, this will only make the coming storm, that much harder to navigate :bhead

Glad to see someone took up my recommendation that the world needs a little Blue Dream right now.  :cheers:
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Eagler on April 29, 2020, 03:09:23 PM
That is one positive IMHO that might/ should come out of this upcoming economic crash, the legalization of your blue dream and all the other crazy names they call cannabis these days at a national level.

It took the great depression to lift the prohibition of booze

Eagler
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Arlo on April 29, 2020, 03:13:21 PM
... your blue dream ...

Good to see you show some political restraint there.  :cool:
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Busher on April 29, 2020, 03:19:23 PM
Good to see you show some political restraint there.  :cool:

 :rofl :rofl :rofl :rofl :rofl
Title: Re: Covid 19 Prevention discussion ONLY
Post by: Shuffler on April 29, 2020, 03:34:39 PM
:uhoh I dont have a "timeline" infront of me at this second...so this is JUST A QUESTION. "CHINA" warned the world? As I remember there was a DOCTOR, in China that was trying to blow the whistle? It was because China tried to silence said Dr.(and eventually he was be it Cov or FMJ) is why the W.H.O was late acknowledging the danger? It doesnt matter really. WHO is corrupted, CHINA made it, ITS a weapon, The AP says, Q said,FoxNews said,FauxNews said, LEFT TWIX NO RIGHT TWIX  is meaningless now. We can argue that stoole till the end. Views one way or the other doesnt matter...WE ARE ALL IN THE SAME BOAT NOW   I dont care if you are man made..natural enhanced or what ever you are....instead of throwing water into said boat, just acknowledge someone looks and things different, and just Row Row Row...whomever the Captain is I aint seen proof that this boat even has a Wheel let alone a Rudder. I know I am not in charge and both sides of any Rowing Team have to work together. Eh doesnt matter just hate all this bickering, this will only make the coming storm, that much harder to navigate :bhead

As long as Americans stick together, it will not matter what anyone else does.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: TheBug on April 29, 2020, 03:42:48 PM
That is one positive IMHO that might/ should come out of this upcoming economic crash, the legalization of your blue dream and all the other crazy names they call cannabis these days at a national level.

It took the great depression to lift the prohibition of booze

Eagler

One can only hope that justice will prevail. 

It's a specific strain name, not just a crazy name for cannabis.
Title: Re: Covid 19 Prevention discussion ONLY
Post by: hitech on April 29, 2020, 05:47:49 PM
Sigh time to lock.