How was CG balancing handled in WW2 aircraft?

[RTHolmes]

... elevator trim isn't used to "manage" CG.

indeed, its used to "manage" the effects of changes to CG, as I said.


a subtle distinction, but enough to argue over apparently.

[B4Buster]

Now when a pilot does weight and balance calculations, we use arms and weights to determine the moment, (Weight x Arm = Moment) which we then verify is (the moment) within CG limits. I have always been curious if arms, and the whole idea of the moment of the aircraft was used in WWII times.

Does anyone know?

[FLS]

ok so thats Wmaker, MachFly and BravoT who think that WWII fighter pilots DIDNT use the elevator trim to trim the aircraft for level flight to compensate for changes in C_G due to fuel use and ords release. anyone else?

I don't think you disagree, you're just talking about 2 different things.

[RTHolmes]

certainly RAF aircraft had tables with all the weights and moments for removable loads:

http://www.spitfireperformance.com/rb141weights.html has a transcript of the XIV's weight/moment chart.

[B4Buster]

certainly RAF aircraft had tables with all the weights and moments for removable loads:

http://www.spitfireperformance.com/rb141weights.html has a transcript of the XIV's weight/moment chart.

Awesome! Thanks for that. I figured that it was used then, but never bothered to research.

[bustr]

Did anyone notice this from the weights paper for the XIV?

2.2. In addition to the above load the following alternative items may be carried:-

...........(a) 30 gallon tinned steel drop tank.
...........(b) 30 gallon vulcanized fibre drop tank.
...........(c) 30 gallon wood drop tank.
...........(d) 90 gallon tinned steel drop tank.
...........(e) 250 lb. G.P. or S.A.P. bomb.
...........(f) 500 lb. G.P., M.C. or S.A.P. bomb.

[hitech]

That's why every real world pilot knows what PAT (or APT) means.

This one doesn't know. So what does it stand for?

Btw does anyone else use CIGAR and FTP?

HiTech

[bustr]

Gurgelsnort!!!!!!!!.........

You saying your comic book airplanes are grown in a test tube? Who are the gene donors?.....


"Cigar" (Compact Idiosyncratic Gapped Alignment Report) format is a compressed (run-length encoded) pairwise alignment format. It is useful for representing long (e.g. genomic) pairwise alignments. It is used in SAM format to represent alignments of reads to a reference genome sequence.

An 'extended' CIGAR string must be following motif: ([0-9]+[MIDNSHP])+|\*. Each character is preceded by a number, giving the base counts of the event, MIDNSH or P.

standard cigar:


M match

I insertion

D deletion


extended cigar


N gap

S substitution

H hard clipping

P padding

= sequence match
X sequence mismatch
Complete genomics data specific
B= move back (1 complete genomics read consist of several contiguous stretches, separated by gaps, in which first two stretches may overlap)

REF: AGCTAGCATCGTGTCGCCCGTCTAGCATA CGCATGATCGACTGTCAGCTAGTCAGACT AGTCGATCGATGTG
    READ:       gggGTGTAACC-GACTAGgggg

[MachFly]

ok so thats Wmaker, MachFly and BravoT who think that WWII fighter pilots DIDNT use the elevator trim to trim the aircraft for level flight to compensate for changes in C_G due to fuel use and ords release. anyone else?

Trim has nothing to do CG. As some people explained trim is just to relive pressure from the stick, CG changes the performance of the aircraft.

For example as you accelerate you start producing more lift and the aircraft wants to pitch up, so instead of keeping constant pressure on the stick you trim the nose down. When your cruising (even without autopilot) you want to trim the airplane for straight and level flight at that airspeed so you can let go of the stick and relax, the plane will fly on it's own.

[MachFly]

That's why every real world pilot knows what PAT (or APT) means.

This one doesn't know. So what does it stand for?

I think it stands for Power Attitude Trim and the other one is Attitude Power Trim. But I had to google for it and had no idea what it meant before, and I'm still not sure what your supposed to do with that acronym. Also the only place where I could find the definition was a forum of some other flying game...

[MachFly]

Now when a pilot does weight and balance calculations, we use arms and weights to determine the moment, (Weight x Arm = Moment) which we then verify is (the moment) within CG limits. I have always been curious if arms, and the whole idea of the moment of the aircraft was used in WWII times.

Does anyone know?

Most modern aircraft have that so you could simply calculate it. But on the Decathlon that I fly (70s design) the POH gives you a chart with Weight on the Y axis and Moment on the X axis so you can do the whole W&B without worrying about the arm. However I think this more depends on the manufacturer than the time when the aircraft was designed.

[BravoT]

This one doesn't know. So what does it stand for?

Btw does anyone else use CIGAR and FTP?

HiTech

Power Attitude Trim and Attitude Power Trim

Really?  I thought it was one of the basics taught to all pilots.  Then again, I'm a Canadian so maybe we do things differently, eh? 

[bj229r]

Obviously, WW hasn't seen this yet...THEN, we will know!

[Wmaker]

ok so thats Wmaker, MachFly and BravoT who think that WWII fighter pilots DIDNT use the elevator trim to trim the aircraft for level flight to compensate for changes in C_G due to fuel use and ords release. anyone else?

Of course trim can be used in these kind of situations. I've read that a single adult person moving through the passenger compartment of DC-3 can be felt in the controls.

indeed, its used to "manage" the effects of changes to CG, as I said.


a subtle distinction, but enough to argue over apparently.

*shrug*

I think it is a pretty clear distinction. When the only word to a question how aircraft CoG is managed is "Trim". Aircraft are designed so that consumables are usually located near the CoG or consumed in an order which keeps the CoG in check even though a fuel tank for example has a long moment arm.

[colmbo]

Trim has nothing to do CG.

Incorrect.  If there is a change in the C of G there will be need for a trim change.